Incidental Mutation 'R4428:Skp2'
ID328290
Institutional Source Beutler Lab
Gene Symbol Skp2
Ensembl Gene ENSMUSG00000054115
Gene NameS-phase kinase-associated protein 2 (p45)
SynonymsFBXL1
MMRRC Submission 041698-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4428 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location9111985-9155425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9116947 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 325 (N325K)
Ref Sequence ENSEMBL: ENSMUSP00000106215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096482] [ENSMUST00000110585] [ENSMUST00000190131]
Predicted Effect probably benign
Transcript: ENSMUST00000096482
AA Change: N325K

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000094225
Gene: ENSMUSG00000054115
AA Change: N325K

DomainStartEndE-ValueType
FBOX 100 140 3.7e-8 SMART
LRR 205 229 1.27e2 SMART
LRR 230 254 1.28e1 SMART
LRR 255 280 2.91e1 SMART
LRR 334 359 2.83e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110585
AA Change: N325K

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106215
Gene: ENSMUSG00000054115
AA Change: N325K

DomainStartEndE-ValueType
FBOX 100 140 3.7e-8 SMART
Blast:LRR 205 229 5e-7 BLAST
Blast:LRR 229 253 3e-7 BLAST
Blast:LRR 255 284 3e-10 BLAST
Blast:LRR 309 334 3e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000190131
AA Change: N290K

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139997
Gene: ENSMUSG00000054115
AA Change: N290K

DomainStartEndE-ValueType
FBOX 65 105 2.3e-10 SMART
LRR 170 194 5.3e-1 SMART
LRR 195 219 5.3e-2 SMART
LRR 220 245 1.2e-1 SMART
LRR 299 324 1.2e-1 SMART
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class; in addition to an F-box, this protein contains 10 tandem leucine-rich repeats. This protein is an essential element of the cyclin A-CDK2 S-phase kinase. It specifically recognizes phosphorylated cyclin-dependent kinase inhibitor 1B (CDKN1B, also referred to as p27 or KIP1) predominantly in S phase and interacts with S-phase kinase-associated protein 1 (SKP1 or p19). In addition, this gene is established as a protooncogene causally involved in the pathogenesis of lymphomas. Alternative splicing of this gene generates three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, enlarged cell and nuclear sizes, polyploidy, reduced cell growth rate, overduplication of centrosomes, increased apoptosis rate, delayed wound healing, and aberrant immunoglobulin V(D)J recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc1 T A 16: 14,445,300 V708E probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccdc18 A G 5: 108,136,077 Y82C probably benign Het
Cd82 T C 2: 93,419,869 Y266C probably damaging Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cmpk1 T C 4: 114,963,362 E180G probably benign Het
Dock8 T C 19: 25,200,499 I2066T probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fgf3 T C 7: 144,840,707 V86A probably damaging Het
Frem2 A G 3: 53,654,338 I916T probably benign Het
Gsk3b T A 16: 38,193,936 L252Q probably damaging Het
Kif18a A G 2: 109,288,121 T94A probably damaging Het
Klhdc1 T A 12: 69,268,226 probably benign Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Mapk7 T C 11: 61,489,229 D701G possibly damaging Het
Mbd5 A T 2: 49,279,764 Q47L possibly damaging Het
Nrcam A G 12: 44,576,775 D1049G possibly damaging Het
Olfml2a G T 2: 38,941,743 M111I probably damaging Het
Olfr402 T C 11: 74,155,199 F15S probably damaging Het
Pld2 A T 11: 70,541,334 H93L probably damaging Het
Pomgnt2 T C 9: 121,982,254 E487G possibly damaging Het
Psg17 G T 7: 18,816,792 N379K probably benign Het
Rfk T A 19: 17,398,595 H84Q possibly damaging Het
Scn8a A G 15: 100,983,903 Y617C probably damaging Het
Sema3d T C 5: 12,448,120 F31S probably benign Het
Shq1 T C 6: 100,670,928 Y45C probably damaging Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sp8 T A 12: 118,849,203 S264R possibly damaging Het
Sun1 T C 5: 139,234,475 probably benign Het
Tardbp A G 4: 148,625,202 V54A possibly damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem68 A T 4: 3,569,534 I52K probably benign Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Umps A C 16: 33,961,586 V322G probably damaging Het
Vmn2r109 T C 17: 20,553,024 D445G probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r4 C T 3: 64,415,169 G43E probably damaging Het
Other mutations in Skp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Skp2 APN 15 9139487 missense probably benign 0.00
IGL02135:Skp2 APN 15 9125147 missense probably benign
R0050:Skp2 UTSW 15 9125091 missense probably benign 0.03
R0129:Skp2 UTSW 15 9125193 missense probably damaging 1.00
R0238:Skp2 UTSW 15 9127884 critical splice donor site probably null
R0238:Skp2 UTSW 15 9127884 critical splice donor site probably null
R1404:Skp2 UTSW 15 9116925 nonsense probably null
R1404:Skp2 UTSW 15 9116925 nonsense probably null
R1503:Skp2 UTSW 15 9127911 missense probably damaging 1.00
R1660:Skp2 UTSW 15 9125114 missense probably benign 0.03
R1746:Skp2 UTSW 15 9139443 missense possibly damaging 0.58
R2031:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2034:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2087:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2088:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2090:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2091:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R4272:Skp2 UTSW 15 9116860 critical splice donor site probably null
R4747:Skp2 UTSW 15 9113839 missense possibly damaging 0.93
R5734:Skp2 UTSW 15 9139479 missense possibly damaging 0.85
R6963:Skp2 UTSW 15 9139428 splice site probably null
R7452:Skp2 UTSW 15 9113832 missense probably damaging 1.00
R7481:Skp2 UTSW 15 9113817 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGCACATCAATATCAATGTTCATGC -3'
(R):5'- GACCATGACATCTGTTTGCC -3'

Sequencing Primer
(F):5'- TGCTTTGAACATGTATTCATCCATC -3'
(R):5'- TTGTACCATAATTAAACGATGCCCC -3'
Posted On2015-07-07