Incidental Mutation 'R4428:Cldn8'
ID328295
Institutional Source Beutler Lab
Gene Symbol Cldn8
Ensembl Gene ENSMUSG00000050520
Gene Nameclaudin 8
Synonyms
MMRRC Submission 041698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R4428 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location88560828-88563183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 88562731 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 102 (M102R)
Ref Sequence ENSEMBL: ENSMUSP00000051887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049697]
Predicted Effect probably damaging
Transcript: ENSMUST00000049697
AA Change: M102R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051887
Gene: ENSMUSG00000050520
AA Change: M102R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 2.9e-32 PFAM
Pfam:Claudin_2 15 184 5.6e-10 PFAM
Meta Mutation Damage Score 0.328 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: This intronless gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a paracellular cation barrier. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc1 T A 16: 14,445,300 V708E probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Ccdc18 A G 5: 108,136,077 Y82C probably benign Het
Cd82 T C 2: 93,419,869 Y266C probably damaging Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cmpk1 T C 4: 114,963,362 E180G probably benign Het
Dock8 T C 19: 25,200,499 I2066T probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fgf3 T C 7: 144,840,707 V86A probably damaging Het
Frem2 A G 3: 53,654,338 I916T probably benign Het
Gsk3b T A 16: 38,193,936 L252Q probably damaging Het
Kif18a A G 2: 109,288,121 T94A probably damaging Het
Klhdc1 T A 12: 69,268,226 probably benign Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Mapk7 T C 11: 61,489,229 D701G possibly damaging Het
Mbd5 A T 2: 49,279,764 Q47L possibly damaging Het
Nrcam A G 12: 44,576,775 D1049G possibly damaging Het
Olfml2a G T 2: 38,941,743 M111I probably damaging Het
Olfr402 T C 11: 74,155,199 F15S probably damaging Het
Pld2 A T 11: 70,541,334 H93L probably damaging Het
Pomgnt2 T C 9: 121,982,254 E487G possibly damaging Het
Psg17 G T 7: 18,816,792 N379K probably benign Het
Rfk T A 19: 17,398,595 H84Q possibly damaging Het
Scn8a A G 15: 100,983,903 Y617C probably damaging Het
Sema3d T C 5: 12,448,120 F31S probably benign Het
Shq1 T C 6: 100,670,928 Y45C probably damaging Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Skp2 A T 15: 9,116,947 N325K probably benign Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sp8 T A 12: 118,849,203 S264R possibly damaging Het
Sun1 T C 5: 139,234,475 probably benign Het
Tardbp A G 4: 148,625,202 V54A possibly damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem68 A T 4: 3,569,534 I52K probably benign Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Umps A C 16: 33,961,586 V322G probably damaging Het
Vmn2r109 T C 17: 20,553,024 D445G probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r4 C T 3: 64,415,169 G43E probably damaging Het
Other mutations in Cldn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02888:Cldn8 APN 16 88562383 missense probably benign 0.00
R0038:Cldn8 UTSW 16 88563034 start codon destroyed probably null 1.00
R0038:Cldn8 UTSW 16 88563034 start codon destroyed probably null 1.00
R0332:Cldn8 UTSW 16 88562358 synonymous silent
R0690:Cldn8 UTSW 16 88562639 missense probably damaging 1.00
R1496:Cldn8 UTSW 16 88562401 missense probably benign
R1832:Cldn8 UTSW 16 88562858 missense probably benign 0.07
R3052:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R3053:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4429:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4430:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4431:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4465:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4485:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4659:Cldn8 UTSW 16 88562408 missense probably benign
R4660:Cldn8 UTSW 16 88562408 missense probably benign
R4662:Cldn8 UTSW 16 88562408 missense probably benign
R4679:Cldn8 UTSW 16 88562408 missense probably benign
R4741:Cldn8 UTSW 16 88562408 missense probably benign
R6591:Cldn8 UTSW 16 88562535 missense possibly damaging 0.73
R6691:Cldn8 UTSW 16 88562535 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TTTAGGGCCACATCCACCAG -3'
(R):5'- TGTGACTATCATGCCTCAGTG -3'

Sequencing Primer
(F):5'- CCAGTGGGTTGTAGAAGTCTC -3'
(R):5'- AGAGTGTCTGCCTTCATCGAAAG -3'
Posted On2015-07-07