Incidental Mutation 'R4429:Zfp661'
ID328307
Institutional Source Beutler Lab
Gene Symbol Zfp661
Ensembl Gene ENSMUSG00000034800
Gene Namezinc finger protein 661
Synonyms
MMRRC Submission 041699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R4429 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location127574662-127587094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127578708 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 57 (V57A)
Ref Sequence ENSEMBL: ENSMUSP00000132820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077422] [ENSMUST00000110366] [ENSMUST00000110368] [ENSMUST00000164551]
Predicted Effect probably damaging
Transcript: ENSMUST00000077422
AA Change: V57A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000076637
Gene: ENSMUSG00000034800
AA Change: V57A

DomainStartEndE-ValueType
KRAB 14 74 1.33e-28 SMART
ZnF_C2H2 169 191 1.12e-3 SMART
ZnF_C2H2 197 219 6.42e-4 SMART
ZnF_C2H2 225 247 7.37e-4 SMART
ZnF_C2H2 253 275 9.22e-5 SMART
ZnF_C2H2 281 303 9.73e-4 SMART
ZnF_C2H2 309 331 1.04e-3 SMART
ZnF_C2H2 337 359 5.67e-5 SMART
ZnF_C2H2 365 387 5.99e-4 SMART
ZnF_C2H2 393 413 4.94e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110366
AA Change: V57A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105995
Gene: ENSMUSG00000034800
AA Change: V57A

DomainStartEndE-ValueType
KRAB 14 74 1.33e-28 SMART
ZnF_C2H2 169 191 1.12e-3 SMART
ZnF_C2H2 197 219 6.42e-4 SMART
ZnF_C2H2 225 247 7.37e-4 SMART
ZnF_C2H2 253 275 9.22e-5 SMART
ZnF_C2H2 281 303 9.73e-4 SMART
ZnF_C2H2 309 331 1.04e-3 SMART
ZnF_C2H2 337 359 5.67e-5 SMART
ZnF_C2H2 365 387 5.99e-4 SMART
ZnF_C2H2 393 413 4.94e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110368
AA Change: V57A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105997
Gene: ENSMUSG00000034800
AA Change: V57A

DomainStartEndE-ValueType
KRAB 14 74 1.33e-28 SMART
ZnF_C2H2 169 191 1.12e-3 SMART
ZnF_C2H2 197 219 6.42e-4 SMART
ZnF_C2H2 225 247 7.37e-4 SMART
ZnF_C2H2 253 275 9.22e-5 SMART
ZnF_C2H2 281 303 9.73e-4 SMART
ZnF_C2H2 309 331 1.04e-3 SMART
ZnF_C2H2 337 359 5.67e-5 SMART
ZnF_C2H2 365 387 5.99e-4 SMART
ZnF_C2H2 393 413 4.94e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164551
AA Change: V57A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132820
Gene: ENSMUSG00000034800
AA Change: V57A

DomainStartEndE-ValueType
KRAB 14 74 1.33e-28 SMART
ZnF_C2H2 169 191 1.12e-3 SMART
ZnF_C2H2 197 219 6.42e-4 SMART
ZnF_C2H2 225 247 7.37e-4 SMART
ZnF_C2H2 253 275 9.22e-5 SMART
ZnF_C2H2 281 303 9.73e-4 SMART
ZnF_C2H2 309 331 1.04e-3 SMART
ZnF_C2H2 337 359 5.67e-5 SMART
ZnF_C2H2 365 387 5.99e-4 SMART
ZnF_C2H2 393 413 4.94e0 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the C2H2-type zinc-finger protein family. The exact function of this gene is not known, however, zinc-finger proteins are known to interact with DNA and function as transcription regulators. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abca5 T C 11: 110,311,410 T390A probably benign Het
Ahcyl2 T G 6: 29,894,875 V452G probably damaging Het
Ano4 T A 10: 88,992,942 N545I probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Catip T A 1: 74,368,732 probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cnpy3 T A 17: 46,747,144 Q111L probably benign Het
Dnah8 A G 17: 30,752,146 N2725D probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Ephb3 G A 16: 21,214,463 E66K probably damaging Het
Gm6594 T A 17: 82,539,494 D79E probably benign Het
Gtf2e2 T A 8: 33,752,493 Y74* probably null Het
Hacd4 A T 4: 88,434,947 F103I possibly damaging Het
Hap1 T C 11: 100,354,272 T38A probably benign Het
Havcr2 T A 11: 46,456,560 D72E probably damaging Het
Iqcg G A 16: 33,019,490 T362I probably benign Het
Lect2 C T 13: 56,545,725 probably null Het
Lemd3 T C 10: 120,977,988 T447A probably benign Het
Lrrc72 T C 12: 36,208,624 N78S probably damaging Het
Map3k14 A G 11: 103,227,584 L592P probably damaging Het
Meioc T C 11: 102,675,720 Y721H probably damaging Het
Mrps10 T A 17: 47,378,199 probably null Het
Myo5c A G 9: 75,294,001 Y1406C probably damaging Het
Myo7a T C 7: 98,053,188 Y2098C probably damaging Het
Nol9 C T 4: 152,041,174 T194I probably damaging Het
Nox3 G A 17: 3,682,958 T206I probably benign Het
Nsd2 T G 5: 33,843,202 M21R probably damaging Het
Pcdh9 T C 14: 93,887,384 N327S probably damaging Het
Pclo T G 5: 14,678,100 probably benign Het
Pparg T A 6: 115,440,023 M59K probably benign Het
Prag1 A G 8: 36,146,642 K1116R probably damaging Het
Rhbdf1 C T 11: 32,213,369 E368K probably benign Het
Rita1 A G 5: 120,609,561 V224A probably damaging Het
Rsph6a T A 7: 19,074,063 W384R probably damaging Het
Scn1a A T 2: 66,350,985 Y65N possibly damaging Het
Serpina5 C A 12: 104,103,406 F292L probably benign Het
Sf3b3 A C 8: 110,826,118 L511V probably benign Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slco6d1 T C 1: 98,496,366 V581A possibly damaging Het
Sptbn2 T C 19: 4,738,355 Y1121H probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Timm29 G C 9: 21,593,479 A148P probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Uba6 C T 5: 86,120,547 V941I probably damaging Het
Vmn1r174 T C 7: 23,754,140 V77A probably benign Het
Zfp867 C T 11: 59,465,037 D64N possibly damaging Het
Zp3r T C 1: 130,591,391 T294A possibly damaging Het
Other mutations in Zfp661
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0139:Zfp661 UTSW 2 127578612 missense possibly damaging 0.93
R0217:Zfp661 UTSW 2 127577291 missense probably damaging 0.98
R0402:Zfp661 UTSW 2 127577720 nonsense probably null
R4689:Zfp661 UTSW 2 127577548 missense probably damaging 1.00
R4881:Zfp661 UTSW 2 127578644 missense probably benign 0.01
R5192:Zfp661 UTSW 2 127577062 missense possibly damaging 0.83
R5996:Zfp661 UTSW 2 127577048 missense probably damaging 0.97
R6074:Zfp661 UTSW 2 127577873 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATTTGAGCAAAGGTGGCTC -3'
(R):5'- TCGCTGCTTGTGAACTGAGG -3'

Sequencing Primer
(F):5'- AGGTGGCTCCTAACACTCC -3'
(R):5'- ACTACCCTGGTGCCTGC -3'
Posted On2015-07-07