Incidental Mutation 'R4429:Chrna4'
ID328308
Institutional Source Beutler Lab
Gene Symbol Chrna4
Ensembl Gene ENSMUSG00000027577
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 4
Synonymsalpha4 nAChR, Acra-4, a4 nicotinic receptor, Acra4, alpha4-nAChR
MMRRC Submission 041699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R4429 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location181018380-181043546 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181028620 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 448 (S448P)
Ref Sequence ENSEMBL: ENSMUSP00000104479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067120] [ENSMUST00000108851]
Predicted Effect probably damaging
Transcript: ENSMUST00000067120
AA Change: S448P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066338
Gene: ENSMUSG00000027577
AA Change: S448P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 39 245 1.4e-76 PFAM
Pfam:Neur_chan_memb 252 620 1.9e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108851
AA Change: S448P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104479
Gene: ENSMUSG00000027577
AA Change: S448P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 39 245 8.4e-79 PFAM
Pfam:Neur_chan_memb 252 620 3.3e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135766
SMART Domains Protein: ENSMUSP00000125724
Gene: ENSMUSG00000027577

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Neur_chan_LBD 39 130 9.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198922
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nicotinic acetylcholine receptor, which belongs to a superfamily of ligand-gated ion channels that play a role in fast signal transmission at synapses. These pentameric receptors can bind acetylcholine, which causes an extensive change in conformation that leads to the opening of an ion-conducting channel across the plasma membrane. This protein is an integral membrane receptor subunit that can interact with either nAChR beta-2 or nAChR beta-4 to form a functional receptor. Mutations in this gene cause nocturnal frontal lobe epilepsy type 1. Polymorphisms in this gene that provide protection against nicotine addiction have been described. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Nullizygous mice may show reduced chemically-elicited analgesia, susceptibility to seizures, increased anxiety, and altered behavioral responses to nicotine or a new environment. Homozygotes for any of several knock-in alleles exhibit altered nervous system physiology and/or sensitivity to nicotine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abca5 T C 11: 110,311,410 T390A probably benign Het
Ahcyl2 T G 6: 29,894,875 V452G probably damaging Het
Ano4 T A 10: 88,992,942 N545I probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Catip T A 1: 74,368,732 probably benign Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cnpy3 T A 17: 46,747,144 Q111L probably benign Het
Dnah8 A G 17: 30,752,146 N2725D probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Ephb3 G A 16: 21,214,463 E66K probably damaging Het
Gm6594 T A 17: 82,539,494 D79E probably benign Het
Gtf2e2 T A 8: 33,752,493 Y74* probably null Het
Hacd4 A T 4: 88,434,947 F103I possibly damaging Het
Hap1 T C 11: 100,354,272 T38A probably benign Het
Havcr2 T A 11: 46,456,560 D72E probably damaging Het
Iqcg G A 16: 33,019,490 T362I probably benign Het
Lect2 C T 13: 56,545,725 probably null Het
Lemd3 T C 10: 120,977,988 T447A probably benign Het
Lrrc72 T C 12: 36,208,624 N78S probably damaging Het
Map3k14 A G 11: 103,227,584 L592P probably damaging Het
Meioc T C 11: 102,675,720 Y721H probably damaging Het
Mrps10 T A 17: 47,378,199 probably null Het
Myo5c A G 9: 75,294,001 Y1406C probably damaging Het
Myo7a T C 7: 98,053,188 Y2098C probably damaging Het
Nol9 C T 4: 152,041,174 T194I probably damaging Het
Nox3 G A 17: 3,682,958 T206I probably benign Het
Nsd2 T G 5: 33,843,202 M21R probably damaging Het
Pcdh9 T C 14: 93,887,384 N327S probably damaging Het
Pclo T G 5: 14,678,100 probably benign Het
Pparg T A 6: 115,440,023 M59K probably benign Het
Prag1 A G 8: 36,146,642 K1116R probably damaging Het
Rhbdf1 C T 11: 32,213,369 E368K probably benign Het
Rita1 A G 5: 120,609,561 V224A probably damaging Het
Rsph6a T A 7: 19,074,063 W384R probably damaging Het
Scn1a A T 2: 66,350,985 Y65N possibly damaging Het
Serpina5 C A 12: 104,103,406 F292L probably benign Het
Sf3b3 A C 8: 110,826,118 L511V probably benign Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slco6d1 T C 1: 98,496,366 V581A possibly damaging Het
Sptbn2 T C 19: 4,738,355 Y1121H probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Timm29 G C 9: 21,593,479 A148P probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Uba6 C T 5: 86,120,547 V941I probably damaging Het
Vmn1r174 T C 7: 23,754,140 V77A probably benign Het
Zfp661 A G 2: 127,578,708 V57A probably damaging Het
Zfp867 C T 11: 59,465,037 D64N possibly damaging Het
Zp3r T C 1: 130,591,391 T294A possibly damaging Het
Other mutations in Chrna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Chrna4 APN 2 181029391 missense probably benign 0.09
IGL00914:Chrna4 APN 2 181029031 missense probably damaging 1.00
IGL01511:Chrna4 APN 2 181028668 missense probably benign 0.13
IGL02517:Chrna4 APN 2 181029133 missense probably benign 0.01
IGL02715:Chrna4 APN 2 181029581 unclassified probably benign
R1168:Chrna4 UTSW 2 181034138 missense possibly damaging 0.61
R1475:Chrna4 UTSW 2 181029379 missense probably benign 0.44
R1572:Chrna4 UTSW 2 181029307 missense possibly damaging 0.95
R4428:Chrna4 UTSW 2 181028620 missense probably damaging 0.99
R4431:Chrna4 UTSW 2 181028620 missense probably damaging 0.99
R4494:Chrna4 UTSW 2 181028488 missense probably damaging 0.98
R4664:Chrna4 UTSW 2 181037493 missense probably damaging 1.00
R4666:Chrna4 UTSW 2 181037493 missense probably damaging 1.00
R4931:Chrna4 UTSW 2 181028872 missense probably benign 0.00
R5144:Chrna4 UTSW 2 181024830 missense probably damaging 1.00
R5556:Chrna4 UTSW 2 181033980 missense possibly damaging 0.94
R5633:Chrna4 UTSW 2 181029460 missense probably damaging 1.00
R5889:Chrna4 UTSW 2 181028658 missense probably damaging 1.00
R6056:Chrna4 UTSW 2 181029442 missense probably damaging 1.00
R6120:Chrna4 UTSW 2 181024806 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGAAGCAGCTCCATCTTG -3'
(R):5'- CGGAGACTTATCGAATCCATGC -3'

Sequencing Primer
(F):5'- TCCATCTTGGGAAACACAGTACTGG -3'
(R):5'- CTTATCGAATCCATGCACAAGATGG -3'
Posted On2015-07-07