Incidental Mutation 'R4429:Tmem67'
ID328309
Institutional Source Beutler Lab
Gene Symbol Tmem67
Ensembl Gene ENSMUSG00000049488
Gene Nametransmembrane protein 67
Synonymsb2b1291.1Clo, 5330408M12Rik, b2b1163.1Clo
MMRRC Submission 041699-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4429 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location12039355-12090020 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12051473 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 785 (N785I)
Ref Sequence ENSEMBL: ENSMUSP00000103928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050686] [ENSMUST00000108293]
Predicted Effect probably benign
Transcript: ENSMUST00000050686
AA Change: N719I

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000052644
Gene: ENSMUSG00000049488
AA Change: N719I

DomainStartEndE-ValueType
low complexity region 17 23 N/A INTRINSIC
Pfam:Meckelin 166 995 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108293
AA Change: N785I

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103928
Gene: ENSMUSG00000049488
AA Change: N785I

DomainStartEndE-ValueType
low complexity region 83 89 N/A INTRINSIC
Pfam:Meckelin 236 1061 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131145
SMART Domains Protein: ENSMUSP00000115154
Gene: ENSMUSG00000049488

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the primary cilium and to the plasma membrane. The gene functions in centriole migration to the apical membrane and formation of the primary cilium. Multiple transcript variants encoding different isoforms have been found for this gene. Defects in this gene are a cause of Meckel syndrome type 3 (MKS3) and Joubert syndrome type 6 (JBTS6). [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit neonatal/postanal lethality, kidney cysts, and Meckel-Gruber or Joubert syndrome-like phenotypes depending on the filial generation of the backcross to C57BL/6J. Mice homozygous for an ENU-induced allele exhibit cardiovascular defects and cystic kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abca5 T C 11: 110,311,410 T390A probably benign Het
Ahcyl2 T G 6: 29,894,875 V452G probably damaging Het
Ano4 T A 10: 88,992,942 N545I probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Catip T A 1: 74,368,732 probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cnpy3 T A 17: 46,747,144 Q111L probably benign Het
Dnah8 A G 17: 30,752,146 N2725D probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Ephb3 G A 16: 21,214,463 E66K probably damaging Het
Gm6594 T A 17: 82,539,494 D79E probably benign Het
Gtf2e2 T A 8: 33,752,493 Y74* probably null Het
Hacd4 A T 4: 88,434,947 F103I possibly damaging Het
Hap1 T C 11: 100,354,272 T38A probably benign Het
Havcr2 T A 11: 46,456,560 D72E probably damaging Het
Iqcg G A 16: 33,019,490 T362I probably benign Het
Lect2 C T 13: 56,545,725 probably null Het
Lemd3 T C 10: 120,977,988 T447A probably benign Het
Lrrc72 T C 12: 36,208,624 N78S probably damaging Het
Map3k14 A G 11: 103,227,584 L592P probably damaging Het
Meioc T C 11: 102,675,720 Y721H probably damaging Het
Mrps10 T A 17: 47,378,199 probably null Het
Myo5c A G 9: 75,294,001 Y1406C probably damaging Het
Myo7a T C 7: 98,053,188 Y2098C probably damaging Het
Nol9 C T 4: 152,041,174 T194I probably damaging Het
Nox3 G A 17: 3,682,958 T206I probably benign Het
Nsd2 T G 5: 33,843,202 M21R probably damaging Het
Pcdh9 T C 14: 93,887,384 N327S probably damaging Het
Pclo T G 5: 14,678,100 probably benign Het
Pparg T A 6: 115,440,023 M59K probably benign Het
Prag1 A G 8: 36,146,642 K1116R probably damaging Het
Rhbdf1 C T 11: 32,213,369 E368K probably benign Het
Rita1 A G 5: 120,609,561 V224A probably damaging Het
Rsph6a T A 7: 19,074,063 W384R probably damaging Het
Scn1a A T 2: 66,350,985 Y65N possibly damaging Het
Serpina5 C A 12: 104,103,406 F292L probably benign Het
Sf3b3 A C 8: 110,826,118 L511V probably benign Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slco6d1 T C 1: 98,496,366 V581A possibly damaging Het
Sptbn2 T C 19: 4,738,355 Y1121H probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Timm29 G C 9: 21,593,479 A148P probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Uba6 C T 5: 86,120,547 V941I probably damaging Het
Vmn1r174 T C 7: 23,754,140 V77A probably benign Het
Zfp661 A G 2: 127,578,708 V57A probably damaging Het
Zfp867 C T 11: 59,465,037 D64N possibly damaging Het
Zp3r T C 1: 130,591,391 T294A possibly damaging Het
Other mutations in Tmem67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Tmem67 APN 4 12061826 missense probably damaging 0.98
IGL00768:Tmem67 APN 4 12055029 critical splice donor site probably null
IGL00813:Tmem67 APN 4 12058587 splice site probably benign
IGL01070:Tmem67 APN 4 12054750 missense probably benign 0.20
IGL01088:Tmem67 APN 4 12063126 missense probably damaging 1.00
IGL01353:Tmem67 APN 4 12079895 missense probably damaging 1.00
IGL01490:Tmem67 APN 4 12057422 splice site probably benign
IGL01885:Tmem67 APN 4 12057389 missense probably damaging 1.00
IGL02061:Tmem67 APN 4 12053526 missense probably damaging 1.00
IGL02151:Tmem67 APN 4 12068882 missense probably benign 0.35
IGL02166:Tmem67 APN 4 12047313 missense possibly damaging 0.90
IGL02243:Tmem67 APN 4 12070584 missense possibly damaging 0.93
IGL02517:Tmem67 APN 4 12069463 missense possibly damaging 0.67
IGL02736:Tmem67 APN 4 12045789 splice site probably null
R0282:Tmem67 UTSW 4 12087930 missense probably damaging 0.99
R0514:Tmem67 UTSW 4 12089317 missense probably benign
R1221:Tmem67 UTSW 4 12045871 missense possibly damaging 0.92
R1301:Tmem67 UTSW 4 12089400 unclassified probably benign
R1581:Tmem67 UTSW 4 12047814 missense probably damaging 1.00
R1680:Tmem67 UTSW 4 12087840 missense probably benign 0.00
R1804:Tmem67 UTSW 4 12045789 splice site probably null
R2174:Tmem67 UTSW 4 12063730 nonsense probably null
R2191:Tmem67 UTSW 4 12069413 critical splice donor site probably null
R2246:Tmem67 UTSW 4 12040651 missense probably damaging 1.00
R2566:Tmem67 UTSW 4 12079918 missense probably damaging 0.99
R3409:Tmem67 UTSW 4 12073952 missense probably benign 0.00
R3410:Tmem67 UTSW 4 12073952 missense probably benign 0.00
R4078:Tmem67 UTSW 4 12040633 critical splice donor site probably null
R4282:Tmem67 UTSW 4 12073922 missense probably damaging 0.99
R4430:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4431:Tmem67 UTSW 4 12051473 missense possibly damaging 0.52
R4734:Tmem67 UTSW 4 12063158 missense probably benign 0.00
R4856:Tmem67 UTSW 4 12089416 unclassified probably benign
R4865:Tmem67 UTSW 4 12070262 missense probably benign 0.01
R5056:Tmem67 UTSW 4 12070471 missense probably benign 0.29
R5575:Tmem67 UTSW 4 12047886 missense possibly damaging 0.93
R5614:Tmem67 UTSW 4 12061755 missense possibly damaging 0.54
R6030:Tmem67 UTSW 4 12063799 missense probably benign 0.01
R6030:Tmem67 UTSW 4 12063799 missense probably benign 0.01
R6182:Tmem67 UTSW 4 12051402 missense probably benign 0.05
R6562:Tmem67 UTSW 4 12053445 critical splice donor site probably null
R6574:Tmem67 UTSW 4 12063086 missense possibly damaging 0.70
R6696:Tmem67 UTSW 4 12061754 critical splice donor site probably null
R6824:Tmem67 UTSW 4 12051449 missense probably damaging 1.00
R7028:Tmem67 UTSW 4 12075484 missense probably benign 0.12
R7174:Tmem67 UTSW 4 12077337 missense possibly damaging 0.82
R7369:Tmem67 UTSW 4 12053535 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCGCACATGCCTGGATC -3'
(R):5'- AAGTTTCCTACGGCTCCTAAG -3'

Sequencing Primer
(F):5'- CACAGAGAGCTCTATGACTGCTTTG -3'
(R):5'- TTTTCAAGGCAGGTAGGTA -3'
Posted On2015-07-07