Incidental Mutation 'R4429:Nsd2'
ID328313
Institutional Source Beutler Lab
Gene Symbol Nsd2
Ensembl Gene ENSMUSG00000057406
Gene Namenuclear receptor binding SET domain protein 2
Synonyms5830445G22Rik, Whsc1, Whsc1l, C130020C13Rik, 9430010A17Rik, D030027O06Rik, D930023B08Rik
MMRRC Submission 041699-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.568) question?
Stock #R4429 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location33820725-33897975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 33843202 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 21 (M21R)
Ref Sequence ENSEMBL: ENSMUSP00000123460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058096] [ENSMUST00000066854] [ENSMUST00000075812] [ENSMUST00000114397] [ENSMUST00000114399] [ENSMUST00000137191] [ENSMUST00000139845] [ENSMUST00000155880]
Predicted Effect probably damaging
Transcript: ENSMUST00000058096
AA Change: M21R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058940
Gene: ENSMUSG00000057406
AA Change: M21R

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 629 643 N/A INTRINSIC
PHD 669 711 1.36e-6 SMART
RING 670 710 1.5e1 SMART
PHD 716 763 6.81e-1 SMART
RING 717 762 5.25e-2 SMART
PHD 833 873 2.35e-10 SMART
PWWP 878 940 2.67e-23 SMART
AWS 1011 1062 3.74e-27 SMART
SET 1063 1186 4.48e-43 SMART
PostSET 1187 1203 7.56e-4 SMART
low complexity region 1215 1236 N/A INTRINSIC
PHD 1241 1284 1.98e-8 SMART
low complexity region 1347 1360 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066854
AA Change: M21R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067205
Gene: ENSMUSG00000057406
AA Change: M21R

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 630 644 N/A INTRINSIC
PHD 670 712 1.36e-6 SMART
RING 671 711 1.5e1 SMART
PHD 717 764 6.81e-1 SMART
RING 718 763 5.25e-2 SMART
PHD 834 874 2.35e-10 SMART
PWWP 879 941 2.67e-23 SMART
AWS 1012 1063 3.74e-27 SMART
SET 1064 1187 4.48e-43 SMART
PostSET 1188 1204 7.56e-4 SMART
low complexity region 1216 1237 N/A INTRINSIC
PHD 1242 1285 1.98e-8 SMART
low complexity region 1348 1361 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075812
AA Change: M21R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075210
Gene: ENSMUSG00000057406
AA Change: M21R

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 630 644 N/A INTRINSIC
PHD 670 712 1.36e-6 SMART
RING 671 711 1.5e1 SMART
PHD 717 764 6.81e-1 SMART
RING 718 763 5.25e-2 SMART
PHD 834 874 2.35e-10 SMART
PWWP 879 941 2.67e-23 SMART
AWS 1012 1063 3.74e-27 SMART
SET 1064 1187 4.48e-43 SMART
PostSET 1188 1204 7.56e-4 SMART
low complexity region 1216 1237 N/A INTRINSIC
PHD 1242 1285 1.98e-8 SMART
low complexity region 1348 1361 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114397
AA Change: M21R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110039
Gene: ENSMUSG00000057406
AA Change: M21R

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.7e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114399
AA Change: M21R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110041
Gene: ENSMUSG00000057406
AA Change: M21R

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137191
AA Change: M21R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122310
Gene: ENSMUSG00000057406
AA Change: M21R

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139845
AA Change: M21R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123460
Gene: ENSMUSG00000057406
AA Change: M21R

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000141416
AA Change: M2R
SMART Domains Protein: ENSMUSP00000117233
Gene: ENSMUSG00000057406
AA Change: M2R

DomainStartEndE-ValueType
Pfam:PWWP 202 314 1.1e-25 PFAM
low complexity region 379 390 N/A INTRINSIC
HMG 434 504 4.7e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155880
AA Change: M21R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121805
Gene: ENSMUSG00000057406
AA Change: M21R

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains four domains present in other developmental proteins: a PWWP domain, an HMG box, a SET domain, and a PHD-type zinc finger. It is expressed ubiquitously in early development. Wolf-Hirschhorn syndrome (WHS) is a malformation syndrome associated with a hemizygous deletion of the distal short arm of chromosome 4. This gene maps to the 165 kb WHS critical region and has also been involved in the chromosomal translocation t(4;14)(p16.3;q32.3) in multiple myelomas. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Some transcript variants are nonsense-mediated mRNA (NMD) decay candidates, hence not represented as reference sequences. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced fetal size, failed sternum ossification, cleft palate, atrial and ventricular septal defects, stunted growth and postnatal death. Some heterozygotes show severe growth defects, malocclusion, delayed sternum ossification and hypoplasia of the septum secundum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abca5 T C 11: 110,311,410 T390A probably benign Het
Ahcyl2 T G 6: 29,894,875 V452G probably damaging Het
Ano4 T A 10: 88,992,942 N545I probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Catip T A 1: 74,368,732 probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cnpy3 T A 17: 46,747,144 Q111L probably benign Het
Dnah8 A G 17: 30,752,146 N2725D probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Ephb3 G A 16: 21,214,463 E66K probably damaging Het
Gm6594 T A 17: 82,539,494 D79E probably benign Het
Gtf2e2 T A 8: 33,752,493 Y74* probably null Het
Hacd4 A T 4: 88,434,947 F103I possibly damaging Het
Hap1 T C 11: 100,354,272 T38A probably benign Het
Havcr2 T A 11: 46,456,560 D72E probably damaging Het
Iqcg G A 16: 33,019,490 T362I probably benign Het
Lect2 C T 13: 56,545,725 probably null Het
Lemd3 T C 10: 120,977,988 T447A probably benign Het
Lrrc72 T C 12: 36,208,624 N78S probably damaging Het
Map3k14 A G 11: 103,227,584 L592P probably damaging Het
Meioc T C 11: 102,675,720 Y721H probably damaging Het
Mrps10 T A 17: 47,378,199 probably null Het
Myo5c A G 9: 75,294,001 Y1406C probably damaging Het
Myo7a T C 7: 98,053,188 Y2098C probably damaging Het
Nol9 C T 4: 152,041,174 T194I probably damaging Het
Nox3 G A 17: 3,682,958 T206I probably benign Het
Pcdh9 T C 14: 93,887,384 N327S probably damaging Het
Pclo T G 5: 14,678,100 probably benign Het
Pparg T A 6: 115,440,023 M59K probably benign Het
Prag1 A G 8: 36,146,642 K1116R probably damaging Het
Rhbdf1 C T 11: 32,213,369 E368K probably benign Het
Rita1 A G 5: 120,609,561 V224A probably damaging Het
Rsph6a T A 7: 19,074,063 W384R probably damaging Het
Scn1a A T 2: 66,350,985 Y65N possibly damaging Het
Serpina5 C A 12: 104,103,406 F292L probably benign Het
Sf3b3 A C 8: 110,826,118 L511V probably benign Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slco6d1 T C 1: 98,496,366 V581A possibly damaging Het
Sptbn2 T C 19: 4,738,355 Y1121H probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Timm29 G C 9: 21,593,479 A148P probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Uba6 C T 5: 86,120,547 V941I probably damaging Het
Vmn1r174 T C 7: 23,754,140 V77A probably benign Het
Zfp661 A G 2: 127,578,708 V57A probably damaging Het
Zfp867 C T 11: 59,465,037 D64N possibly damaging Het
Zp3r T C 1: 130,591,391 T294A possibly damaging Het
Other mutations in Nsd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Nsd2 APN 5 33855733 missense probably damaging 1.00
IGL00420:Nsd2 APN 5 33883003 missense possibly damaging 0.82
IGL01343:Nsd2 APN 5 33843578 missense probably damaging 1.00
IGL01403:Nsd2 APN 5 33885378 splice site probably benign
IGL01446:Nsd2 APN 5 33861186 splice site probably benign
IGL01571:Nsd2 APN 5 33864687 missense probably benign 0.32
IGL01862:Nsd2 APN 5 33843736 missense probably null 1.00
IGL02040:Nsd2 APN 5 33867571 splice site probably benign
IGL02528:Nsd2 APN 5 33879051 unclassified probably benign
IGL02553:Nsd2 APN 5 33846198 missense probably damaging 1.00
IGL02799:Nsd2 APN 5 33864788 splice site probably benign
IGL02932:Nsd2 APN 5 33880128 missense probably damaging 1.00
Tennis UTSW 5 33843513 missense probably damaging 1.00
R0136:Nsd2 UTSW 5 33855536 missense possibly damaging 0.89
R0372:Nsd2 UTSW 5 33891551 missense probably damaging 0.98
R0521:Nsd2 UTSW 5 33843338 missense probably damaging 1.00
R0548:Nsd2 UTSW 5 33893538 missense probably damaging 1.00
R0726:Nsd2 UTSW 5 33861028 unclassified probably benign
R1018:Nsd2 UTSW 5 33843241 missense probably damaging 1.00
R1638:Nsd2 UTSW 5 33882120 missense possibly damaging 0.87
R1649:Nsd2 UTSW 5 33854640 missense probably damaging 0.98
R1675:Nsd2 UTSW 5 33861149 missense probably benign 0.04
R1900:Nsd2 UTSW 5 33846169 missense probably benign
R2001:Nsd2 UTSW 5 33843402 missense probably damaging 1.00
R2167:Nsd2 UTSW 5 33882919 missense probably damaging 1.00
R2261:Nsd2 UTSW 5 33885527 missense probably damaging 1.00
R2966:Nsd2 UTSW 5 33846122 missense probably benign 0.01
R3931:Nsd2 UTSW 5 33846117 missense probably benign 0.01
R4596:Nsd2 UTSW 5 33882918 missense probably damaging 1.00
R4958:Nsd2 UTSW 5 33892022 missense probably damaging 1.00
R5346:Nsd2 UTSW 5 33879136 missense possibly damaging 0.94
R5957:Nsd2 UTSW 5 33855603 missense probably damaging 1.00
R6054:Nsd2 UTSW 5 33882161 missense probably damaging 1.00
R6124:Nsd2 UTSW 5 33843266 missense probably benign 0.08
R6302:Nsd2 UTSW 5 33867577 missense possibly damaging 0.93
R6390:Nsd2 UTSW 5 33881181 missense probably damaging 1.00
R6496:Nsd2 UTSW 5 33843513 missense probably damaging 1.00
R6828:Nsd2 UTSW 5 33893568 missense probably damaging 0.98
R6925:Nsd2 UTSW 5 33879110 missense probably damaging 1.00
X0020:Nsd2 UTSW 5 33854757 missense probably damaging 1.00
Z1088:Nsd2 UTSW 5 33855738 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTCAGAACTAGAGATACTGACATACC -3'
(R):5'- ATCATGAGCACCAGGTTCTCC -3'

Sequencing Primer
(F):5'- CTGTAGTGTTCTAAGAACCAAA -3'
(R):5'- AGATCTTTCAACTTCTCTGCTGGAAG -3'
Posted On2015-07-07