Incidental Mutation 'R4429:0610040J01Rik'
List |< first << previous [record 72 of 386652] next >> last >|
ID328314
Institutional Source Beutler Lab
Gene Symbol 0610040J01Rik
Ensembl Gene ENSMUSG00000060512
Gene NameRIKEN cDNA 0610040J01 gene
Synonyms
MMRRC Submission 041699-MU
Accession Numbers
Stock #R4429 (G1)
Quality Score154
Status Not validated
Chromosome5
Chromosomal Location63812495-63899619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 63898839 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 306 (G306V)
Ref Sequence ENSEMBL: ENSMUSP00000080443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081747]
Predicted Effect unknown
Transcript: ENSMUST00000081747
AA Change: G306V
SMART Domains Protein: ENSMUSP00000080443
Gene: ENSMUSG00000060512
AA Change: G306V

DomainStartEndE-ValueType
Pfam:DUF4699 9 313 2.5e-123 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810026J23Rik G C 9: 21,593,479 A148P probably damaging Het
A730013G03Rik G C 1: 192,833,740 A492G noncoding transcript Het
Abca5 T C 11: 110,311,410 T390A probably benign Het
Ahcyl2 T G 6: 29,894,875 V452G probably damaging Het
Ano4 T A 10: 88,992,942 N545I probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Catip T A 1: 74,368,732 Y408N unknown Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cnpy3 T A 17: 46,747,144 Q111L probably benign Het
D8Ertd82e A G 8: 36,146,642 K1116R probably damaging Het
Dnah8 A G 17: 30,752,146 N2725D probably damaging Het
Ephb3 G A 16: 21,214,463 E100K probably damaging Het
Gm1564 T C 11: 102,675,720 Y721H probably damaging Het
Gm27047 T A 6: 130,631,011 I15L noncoding transcript Het
Gm6594 T A 17: 82,539,494 D79E probably benign Het
Gtf2e2 T A 8: 33,752,493 Y74* probably null Het
Hacd4 A T 4: 88,434,947 F103I possibly damaging Het
Hap1 T C 11: 100,354,272 T186A probably benign Het
Havcr2 T A 11: 46,456,560 D72E probably damaging Het
Iqcg G A 16: 33,019,490 T362I probably benign Het
Lect2 C T 13: 56,545,725 probably null Het
Lemd3 T C 10: 120,977,988 T447A probably benign Het
Lrrc72 T C 12: 36,208,624 N78S probably damaging Het
Map3k14 A G 11: 103,227,584 L592P probably damaging Het
Mrps10 T A 17: 47,378,199 probably null Het
Myo5c A G 9: 75,294,001 Y1406C probably damaging Het
Myo7a T C 7: 98,053,188 Y2087C probably damaging Het
Nol9 C T 4: 152,041,174 T194I probably damaging Het
Nox3 G A 17: 3,682,958 T206I probably benign Het
Pcdh9 T C 14: 93,887,384 N327S probably damaging Het
Pclo T G 5: 14,678,100 F2324C unknown Het
Pparg T A 6: 115,440,023 M89K probably benign Het
Rhbdf1 C T 11: 32,213,369 E368K probably benign Het
Rita1 A G 5: 120,609,561 V224A probably damaging Het
Rsph6a T A 7: 19,074,063 W639R probably damaging Het
Scn1a A T 2: 66,350,985 Y65N probably damaging Het
Serpina5 C A 12: 104,103,406 F292L probably benign Het
Sf3b3 A C 8: 110,826,118 L511V probably benign Het
Siglecg C T 7: 43,417,926 Q1156* probably null Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slco6d1 T C 1: 98,496,366 V581A possibly damaging Het
Spdl1 C T 11: 34,822,563 G257R noncoding transcript Het
Sptbn2 T C 19: 4,738,355 Y1121H probably damaging Het
St8sia4 A T 1: 95,660,849 N189K noncoding transcript Het
Stk11ip A G 1: 75,528,892 T85A noncoding transcript Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Homo
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Uba6 C T 5: 86,120,547 V941I probably damaging Het
Vmn1r174 T C 7: 23,754,140 V77A probably benign Het
Whsc1 T G 5: 33,843,202 M21R probably damaging Het
Zfp661 A G 2: 127,578,708 V57A probably damaging Het
Zfp867 C T 11: 59,465,037 D64N possibly damaging Het
Zp3r T C 1: 130,591,391 T294A possibly damaging Het
Other mutations in 0610040J01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:0610040J01Rik APN 5 63898383 missense possibly damaging 0.60
IGL02229:0610040J01Rik APN 5 63898353 missense possibly damaging 0.51
IGL02389:0610040J01Rik APN 5 63896483 missense probably benign 0.20
IGL02411:0610040J01Rik APN 5 63898116 missense probably benign 0.00
R0243:0610040J01Rik UTSW 5 63898463 missense probably benign 0.09
R0411:0610040J01Rik UTSW 5 63896491 splice donor site probably benign
R1978:0610040J01Rik UTSW 5 63898537 nonsense probably null
R2072:0610040J01Rik UTSW 5 63898737 missense possibly damaging 0.79
R2202:0610040J01Rik UTSW 5 63898668 missense possibly damaging 0.89
R3161:0610040J01Rik UTSW 5 63896490 splice site probably benign
R3162:0610040J01Rik UTSW 5 63896490 splice site probably benign
R4428:0610040J01Rik UTSW 5 63898839 missense unknown
R4430:0610040J01Rik UTSW 5 63898839 missense unknown
R4431:0610040J01Rik UTSW 5 63898839 missense unknown
R4464:0610040J01Rik UTSW 5 63898839 missense unknown
R4465:0610040J01Rik UTSW 5 63898839 missense unknown
R4467:0610040J01Rik UTSW 5 63898839 missense unknown
R4491:0610040J01Rik UTSW 5 63898469 missense probably damaging 1.00
R5161:0610040J01Rik UTSW 5 63898001 nonsense probably null
R6115:0610040J01Rik UTSW 5 63897974 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGCTGGGACTCACTGAATG -3'
(R):5'- GATGCCCTATACAGCAAGCAGC -3'

Sequencing Primer
(F):5'- TCACTGAATGAGGCAGGGACC -3'
(R):5'- GAGTAGGCACATGCTTCTA -3'
Posted OnJul 07, 2015