Incidental Mutation 'R4429:Uba6'
ID328315
Institutional Source Beutler Lab
Gene Symbol Uba6
Ensembl Gene ENSMUSG00000035898
Gene Nameubiquitin-like modifier activating enzyme 6
SynonymsUbe1l2, 5730469D23Rik
MMRRC Submission 041699-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4429 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location86109287-86172803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86120547 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 941 (V941I)
Ref Sequence ENSEMBL: ENSMUSP00000035328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039373] [ENSMUST00000113373]
Predicted Effect probably damaging
Transcript: ENSMUST00000039373
AA Change: V941I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035328
Gene: ENSMUSG00000035898
AA Change: V941I

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
Pfam:ThiF 44 431 8.9e-29 PFAM
Pfam:E1_FCCH 224 293 1.7e-28 PFAM
Pfam:E1_4HB 294 362 9.8e-21 PFAM
internal_repeat_1 443 588 1.25e-6 PROSPERO
Pfam:UBA_e1_thiolCys 631 884 3.7e-80 PFAM
UBA_e1_C 921 1043 1.04e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113373
AA Change: V910I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109000
Gene: ENSMUSG00000035898
AA Change: V910I

DomainStartEndE-ValueType
Pfam:ThiF 29 167 1.8e-16 PFAM
Pfam:ThiF 428 573 8.5e-34 PFAM
Pfam:UBA_e1_thiolCys 575 619 2.3e-22 PFAM
Pfam:UBACT 817 885 2.9e-28 PFAM
UBA_e1_C 890 1012 1.04e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147734
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of proteins with ubiquitin (UBB; MIM 191339) or ubiquitin-like proteins controls many signaling networks and requires a ubiquitin-activating enzyme (E1), a ubiquitin conjugating enzyme (E2), and a ubiquitin protein ligase (E3). UBE1L2 is an E1 enzyme that initiates the activation and conjugation of ubiquitin-like proteins (Jin et al., 2007 [PubMed 17597759]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice homozygous for a conditional allele activated in neurons exhibit decreased weight, postnatal and premature lethality and altered social behavior and neuronal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abca5 T C 11: 110,311,410 T390A probably benign Het
Ahcyl2 T G 6: 29,894,875 V452G probably damaging Het
Ano4 T A 10: 88,992,942 N545I probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Catip T A 1: 74,368,732 probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cnpy3 T A 17: 46,747,144 Q111L probably benign Het
Dnah8 A G 17: 30,752,146 N2725D probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Ephb3 G A 16: 21,214,463 E66K probably damaging Het
Gm6594 T A 17: 82,539,494 D79E probably benign Het
Gtf2e2 T A 8: 33,752,493 Y74* probably null Het
Hacd4 A T 4: 88,434,947 F103I possibly damaging Het
Hap1 T C 11: 100,354,272 T38A probably benign Het
Havcr2 T A 11: 46,456,560 D72E probably damaging Het
Iqcg G A 16: 33,019,490 T362I probably benign Het
Lect2 C T 13: 56,545,725 probably null Het
Lemd3 T C 10: 120,977,988 T447A probably benign Het
Lrrc72 T C 12: 36,208,624 N78S probably damaging Het
Map3k14 A G 11: 103,227,584 L592P probably damaging Het
Meioc T C 11: 102,675,720 Y721H probably damaging Het
Mrps10 T A 17: 47,378,199 probably null Het
Myo5c A G 9: 75,294,001 Y1406C probably damaging Het
Myo7a T C 7: 98,053,188 Y2098C probably damaging Het
Nol9 C T 4: 152,041,174 T194I probably damaging Het
Nox3 G A 17: 3,682,958 T206I probably benign Het
Nsd2 T G 5: 33,843,202 M21R probably damaging Het
Pcdh9 T C 14: 93,887,384 N327S probably damaging Het
Pclo T G 5: 14,678,100 probably benign Het
Pparg T A 6: 115,440,023 M59K probably benign Het
Prag1 A G 8: 36,146,642 K1116R probably damaging Het
Rhbdf1 C T 11: 32,213,369 E368K probably benign Het
Rita1 A G 5: 120,609,561 V224A probably damaging Het
Rsph6a T A 7: 19,074,063 W384R probably damaging Het
Scn1a A T 2: 66,350,985 Y65N possibly damaging Het
Serpina5 C A 12: 104,103,406 F292L probably benign Het
Sf3b3 A C 8: 110,826,118 L511V probably benign Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slco6d1 T C 1: 98,496,366 V581A possibly damaging Het
Sptbn2 T C 19: 4,738,355 Y1121H probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Timm29 G C 9: 21,593,479 A148P probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Vmn1r174 T C 7: 23,754,140 V77A probably benign Het
Zfp661 A G 2: 127,578,708 V57A probably damaging Het
Zfp867 C T 11: 59,465,037 D64N possibly damaging Het
Zp3r T C 1: 130,591,391 T294A possibly damaging Het
Other mutations in Uba6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Uba6 APN 5 86119407 missense possibly damaging 0.51
IGL01294:Uba6 APN 5 86150048 missense possibly damaging 0.67
IGL01625:Uba6 APN 5 86120529 nonsense probably null
IGL01807:Uba6 APN 5 86122411 missense probably damaging 1.00
IGL01919:Uba6 APN 5 86119386 missense probably benign 0.01
IGL02131:Uba6 APN 5 86150077 missense probably benign 0.18
IGL03107:Uba6 APN 5 86127774 splice site probably benign
R0314:Uba6 UTSW 5 86118087 missense probably damaging 0.99
R0350:Uba6 UTSW 5 86144378 missense possibly damaging 0.48
R0511:Uba6 UTSW 5 86112750 missense probably damaging 1.00
R0964:Uba6 UTSW 5 86119401 missense possibly damaging 0.47
R1086:Uba6 UTSW 5 86127719 missense probably benign 0.00
R1440:Uba6 UTSW 5 86140423 missense probably damaging 1.00
R1564:Uba6 UTSW 5 86154407 missense probably benign
R2377:Uba6 UTSW 5 86124370 missense possibly damaging 0.90
R2420:Uba6 UTSW 5 86132616 critical splice donor site probably null
R2421:Uba6 UTSW 5 86132616 critical splice donor site probably null
R2422:Uba6 UTSW 5 86132616 critical splice donor site probably null
R2924:Uba6 UTSW 5 86159271 missense probably damaging 1.00
R3723:Uba6 UTSW 5 86135047 missense probably damaging 1.00
R3724:Uba6 UTSW 5 86135047 missense probably damaging 1.00
R4590:Uba6 UTSW 5 86112744 missense probably damaging 1.00
R4831:Uba6 UTSW 5 86131338 missense probably benign
R4908:Uba6 UTSW 5 86140434 splice site silent
R5193:Uba6 UTSW 5 86124422 missense probably benign 0.12
R5505:Uba6 UTSW 5 86120546 missense probably benign 0.09
R5560:Uba6 UTSW 5 86131260 missense probably damaging 1.00
R5586:Uba6 UTSW 5 86135047 missense probably damaging 1.00
R5589:Uba6 UTSW 5 86122429 missense probably damaging 0.99
R5787:Uba6 UTSW 5 86112652 makesense probably null
R6255:Uba6 UTSW 5 86164765 missense probably benign 0.25
R6512:Uba6 UTSW 5 86124403 missense probably benign
R6772:Uba6 UTSW 5 86147073 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTGGTGTGGCAAATCAACTGC -3'
(R):5'- AGACCAATTACGTTCCCAAGTAG -3'

Sequencing Primer
(F):5'- TGTGGCAAATCAACTGCTCTGAG -3'
(R):5'- ACGTTCCCAAGTAGTTTAGACTC -3'
Posted On2015-07-07