Incidental Mutation 'R4429:Rita1'
ID328316
Institutional Source Beutler Lab
Gene Symbol Rita1
Ensembl Gene ENSMUSG00000029600
Gene NameRBPJ interacting and tubulin associated 1
Synonyms1110008J03Rik
MMRRC Submission 041699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R4429 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location120594305-120612589 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120609561 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 224 (V224A)
Ref Sequence ENSEMBL: ENSMUSP00000136946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031598] [ENSMUST00000031599] [ENSMUST00000069259] [ENSMUST00000094391] [ENSMUST00000111884] [ENSMUST00000140554] [ENSMUST00000156356] [ENSMUST00000177800]
Predicted Effect probably benign
Transcript: ENSMUST00000031598
SMART Domains Protein: ENSMUSP00000031598
Gene: ENSMUSG00000029599

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Blast:DEXDc 59 101 9e-19 BLAST
DEXDc 114 313 3.5e-58 SMART
HELICc 347 432 7.86e-20 SMART
low complexity region 628 646 N/A INTRINSIC
DBP10CT 706 766 1.45e-25 SMART
low complexity region 778 801 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000031599
AA Change: V224A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031599
Gene: ENSMUSG00000029600
AA Change: V224A

DomainStartEndE-ValueType
low complexity region 235 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069259
SMART Domains Protein: ENSMUSP00000069167
Gene: ENSMUSG00000029601

DomainStartEndE-ValueType
coiled coil region 97 137 N/A INTRINSIC
coiled coil region 209 257 N/A INTRINSIC
coiled coil region 298 348 N/A INTRINSIC
IQ 363 385 5.53e-4 SMART
low complexity region 387 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094391
SMART Domains Protein: ENSMUSP00000091955
Gene: ENSMUSG00000029601

DomainStartEndE-ValueType
coiled coil region 97 137 N/A INTRINSIC
coiled coil region 209 257 N/A INTRINSIC
coiled coil region 331 381 N/A INTRINSIC
IQ 396 418 5.53e-4 SMART
low complexity region 420 458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136070
Predicted Effect probably benign
Transcript: ENSMUST00000140554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147596
Predicted Effect probably benign
Transcript: ENSMUST00000156356
SMART Domains Protein: ENSMUSP00000122910
Gene: ENSMUSG00000029600

DomainStartEndE-ValueType
low complexity region 81 91 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177800
AA Change: V224A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136946
Gene: ENSMUSG00000029600
AA Change: V224A

DomainStartEndE-ValueType
Pfam:RITA 1 253 2.5e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202672
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abca5 T C 11: 110,311,410 T390A probably benign Het
Ahcyl2 T G 6: 29,894,875 V452G probably damaging Het
Ano4 T A 10: 88,992,942 N545I probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Catip T A 1: 74,368,732 probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cnpy3 T A 17: 46,747,144 Q111L probably benign Het
Dnah8 A G 17: 30,752,146 N2725D probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Ephb3 G A 16: 21,214,463 E66K probably damaging Het
Gm6594 T A 17: 82,539,494 D79E probably benign Het
Gtf2e2 T A 8: 33,752,493 Y74* probably null Het
Hacd4 A T 4: 88,434,947 F103I possibly damaging Het
Hap1 T C 11: 100,354,272 T38A probably benign Het
Havcr2 T A 11: 46,456,560 D72E probably damaging Het
Iqcg G A 16: 33,019,490 T362I probably benign Het
Lect2 C T 13: 56,545,725 probably null Het
Lemd3 T C 10: 120,977,988 T447A probably benign Het
Lrrc72 T C 12: 36,208,624 N78S probably damaging Het
Map3k14 A G 11: 103,227,584 L592P probably damaging Het
Meioc T C 11: 102,675,720 Y721H probably damaging Het
Mrps10 T A 17: 47,378,199 probably null Het
Myo5c A G 9: 75,294,001 Y1406C probably damaging Het
Myo7a T C 7: 98,053,188 Y2098C probably damaging Het
Nol9 C T 4: 152,041,174 T194I probably damaging Het
Nox3 G A 17: 3,682,958 T206I probably benign Het
Nsd2 T G 5: 33,843,202 M21R probably damaging Het
Pcdh9 T C 14: 93,887,384 N327S probably damaging Het
Pclo T G 5: 14,678,100 probably benign Het
Pparg T A 6: 115,440,023 M59K probably benign Het
Prag1 A G 8: 36,146,642 K1116R probably damaging Het
Rhbdf1 C T 11: 32,213,369 E368K probably benign Het
Rsph6a T A 7: 19,074,063 W384R probably damaging Het
Scn1a A T 2: 66,350,985 Y65N possibly damaging Het
Serpina5 C A 12: 104,103,406 F292L probably benign Het
Sf3b3 A C 8: 110,826,118 L511V probably benign Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slco6d1 T C 1: 98,496,366 V581A possibly damaging Het
Sptbn2 T C 19: 4,738,355 Y1121H probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Timm29 G C 9: 21,593,479 A148P probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Uba6 C T 5: 86,120,547 V941I probably damaging Het
Vmn1r174 T C 7: 23,754,140 V77A probably benign Het
Zfp661 A G 2: 127,578,708 V57A probably damaging Het
Zfp867 C T 11: 59,465,037 D64N possibly damaging Het
Zp3r T C 1: 130,591,391 T294A possibly damaging Het
Other mutations in Rita1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02269:Rita1 APN 5 120609793 missense probably damaging 0.98
IGL02273:Rita1 APN 5 120609793 missense probably damaging 0.98
IGL02274:Rita1 APN 5 120609793 missense probably damaging 0.98
IGL02302:Rita1 APN 5 120609793 missense probably damaging 0.98
IGL02313:Rita1 APN 5 120609793 missense probably damaging 0.98
IGL02315:Rita1 APN 5 120609793 missense probably damaging 0.98
IGL02326:Rita1 APN 5 120609793 missense probably damaging 0.98
IGL02329:Rita1 APN 5 120609793 missense probably damaging 0.98
IGL02330:Rita1 APN 5 120609793 missense probably damaging 0.98
IGL02331:Rita1 APN 5 120609793 missense probably damaging 0.98
IGL02750:Rita1 APN 5 120609651 missense possibly damaging 0.58
R0360:Rita1 UTSW 5 120609772 missense probably benign 0.02
R0490:Rita1 UTSW 5 120611565 missense probably damaging 1.00
R1822:Rita1 UTSW 5 120609580 missense possibly damaging 0.50
R2440:Rita1 UTSW 5 120609939 missense probably damaging 1.00
R4870:Rita1 UTSW 5 120611383 missense probably damaging 1.00
R5009:Rita1 UTSW 5 120611383 missense probably damaging 1.00
R5941:Rita1 UTSW 5 120609561 missense probably benign 0.35
R6475:Rita1 UTSW 5 120611570 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATATGGCCCATCCTCACCG -3'
(R):5'- AAAGCTCCGGACCCTTTTCTG -3'

Sequencing Primer
(F):5'- AGGCGTTTCCAGCATCTG -3'
(R):5'- TGCAGGCTCCCAGATGTCATC -3'
Posted On2015-07-07