Incidental Mutation 'R4429:Ahcyl2'
ID328317
Institutional Source Beutler Lab
Gene Symbol Ahcyl2
Ensembl Gene ENSMUSG00000029772
Gene NameS-adenosylhomocysteine hydrolase-like 2
Synonyms
MMRRC Submission 041699-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.675) question?
Stock #R4429 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location29768011-29912310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 29894875 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 452 (V452G)
Ref Sequence ENSEMBL: ENSMUSP00000100060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064872] [ENSMUST00000102995] [ENSMUST00000115238] [ENSMUST00000115242] [ENSMUST00000125911]
Predicted Effect probably damaging
Transcript: ENSMUST00000064872
AA Change: V348G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067638
Gene: ENSMUSG00000029772
AA Change: V348G

DomainStartEndE-ValueType
low complexity region 38 68 N/A INTRINSIC
AdoHcyase 82 507 4.47e-268 SMART
AdoHcyase_NAD 267 428 2.21e-103 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102995
AA Change: V452G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100060
Gene: ENSMUSG00000029772
AA Change: V452G

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 35 80 N/A INTRINSIC
low complexity region 142 172 N/A INTRINSIC
AdoHcyase 186 611 4.47e-268 SMART
AdoHcyase_NAD 371 532 2.21e-103 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115238
AA Change: V348G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110893
Gene: ENSMUSG00000029772
AA Change: V348G

DomainStartEndE-ValueType
low complexity region 38 68 N/A INTRINSIC
AdoHcyase 82 507 4.47e-268 SMART
AdoHcyase_NAD 267 428 2.21e-103 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115242
AA Change: V453G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000110897
Gene: ENSMUSG00000029772
AA Change: V453G

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 35 80 N/A INTRINSIC
low complexity region 143 173 N/A INTRINSIC
AdoHcyase 187 612 4.47e-268 SMART
AdoHcyase_NAD 372 533 2.21e-103 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125911
AA Change: V244G

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135518
Gene: ENSMUSG00000029772
AA Change: V244G

DomainStartEndE-ValueType
AdoHcyase 1 403 8.07e-243 SMART
AdoHcyase_NAD 163 324 2.21e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141304
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201020
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homotetramer and may be involved in the conversion of S-adenosyl-L-homocysteine to L-homocysteine and adenosine. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abca5 T C 11: 110,311,410 T390A probably benign Het
Ano4 T A 10: 88,992,942 N545I probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Catip T A 1: 74,368,732 probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cnpy3 T A 17: 46,747,144 Q111L probably benign Het
Dnah8 A G 17: 30,752,146 N2725D probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Ephb3 G A 16: 21,214,463 E66K probably damaging Het
Gm6594 T A 17: 82,539,494 D79E probably benign Het
Gtf2e2 T A 8: 33,752,493 Y74* probably null Het
Hacd4 A T 4: 88,434,947 F103I possibly damaging Het
Hap1 T C 11: 100,354,272 T38A probably benign Het
Havcr2 T A 11: 46,456,560 D72E probably damaging Het
Iqcg G A 16: 33,019,490 T362I probably benign Het
Lect2 C T 13: 56,545,725 probably null Het
Lemd3 T C 10: 120,977,988 T447A probably benign Het
Lrrc72 T C 12: 36,208,624 N78S probably damaging Het
Map3k14 A G 11: 103,227,584 L592P probably damaging Het
Meioc T C 11: 102,675,720 Y721H probably damaging Het
Mrps10 T A 17: 47,378,199 probably null Het
Myo5c A G 9: 75,294,001 Y1406C probably damaging Het
Myo7a T C 7: 98,053,188 Y2098C probably damaging Het
Nol9 C T 4: 152,041,174 T194I probably damaging Het
Nox3 G A 17: 3,682,958 T206I probably benign Het
Nsd2 T G 5: 33,843,202 M21R probably damaging Het
Pcdh9 T C 14: 93,887,384 N327S probably damaging Het
Pclo T G 5: 14,678,100 probably benign Het
Pparg T A 6: 115,440,023 M59K probably benign Het
Prag1 A G 8: 36,146,642 K1116R probably damaging Het
Rhbdf1 C T 11: 32,213,369 E368K probably benign Het
Rita1 A G 5: 120,609,561 V224A probably damaging Het
Rsph6a T A 7: 19,074,063 W384R probably damaging Het
Scn1a A T 2: 66,350,985 Y65N possibly damaging Het
Serpina5 C A 12: 104,103,406 F292L probably benign Het
Sf3b3 A C 8: 110,826,118 L511V probably benign Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slco6d1 T C 1: 98,496,366 V581A possibly damaging Het
Sptbn2 T C 19: 4,738,355 Y1121H probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Timm29 G C 9: 21,593,479 A148P probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Uba6 C T 5: 86,120,547 V941I probably damaging Het
Vmn1r174 T C 7: 23,754,140 V77A probably benign Het
Zfp661 A G 2: 127,578,708 V57A probably damaging Het
Zfp867 C T 11: 59,465,037 D64N possibly damaging Het
Zp3r T C 1: 130,591,391 T294A possibly damaging Het
Other mutations in Ahcyl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02966:Ahcyl2 APN 6 29880557 missense probably benign 0.03
IGL03072:Ahcyl2 APN 6 29906501 splice site probably benign
IGL03195:Ahcyl2 APN 6 29906769 splice site probably benign
R0189:Ahcyl2 UTSW 6 29891243 missense probably benign 0.32
R0395:Ahcyl2 UTSW 6 29886168 missense probably damaging 1.00
R0555:Ahcyl2 UTSW 6 29890671 critical splice acceptor site probably benign
R0924:Ahcyl2 UTSW 6 29870628 unclassified probably null
R0930:Ahcyl2 UTSW 6 29870628 unclassified probably null
R1413:Ahcyl2 UTSW 6 29768587 utr 5 prime probably benign
R1446:Ahcyl2 UTSW 6 29891240 missense probably damaging 0.96
R1822:Ahcyl2 UTSW 6 29768584 utr 5 prime probably benign
R1864:Ahcyl2 UTSW 6 29908355 missense probably damaging 1.00
R1865:Ahcyl2 UTSW 6 29908355 missense probably damaging 1.00
R3810:Ahcyl2 UTSW 6 29891261 missense probably benign 0.01
R4932:Ahcyl2 UTSW 6 29890701 missense probably benign 0.22
R5019:Ahcyl2 UTSW 6 29859739 missense possibly damaging 0.96
R5032:Ahcyl2 UTSW 6 29768556 utr 5 prime probably benign
R5396:Ahcyl2 UTSW 6 29859698 intron probably benign
R5604:Ahcyl2 UTSW 6 29908367 missense probably damaging 1.00
R5817:Ahcyl2 UTSW 6 29890721 missense probably damaging 1.00
R5959:Ahcyl2 UTSW 6 29886174 missense probably damaging 1.00
R6159:Ahcyl2 UTSW 6 29908458 missense possibly damaging 0.81
R6531:Ahcyl2 UTSW 6 29886162 missense probably benign 0.41
R7025:Ahcyl2 UTSW 6 29908421 missense probably damaging 1.00
R7478:Ahcyl2 UTSW 6 29903267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAGCTGTCCAGGAAGTG -3'
(R):5'- TACATGCATGTGTGTCTCTCTG -3'

Sequencing Primer
(F):5'- TGTCCAGGAAGTGACACTGTAACTAC -3'
(R):5'- ATAGAACCTGGGTCCTTTGCAAG -3'
Posted On2015-07-07