Incidental Mutation 'R4429:Pparg'
ID328318
Institutional Source Beutler Lab
Gene Symbol Pparg
Ensembl Gene ENSMUSG00000000440
Gene Nameperoxisome proliferator activated receptor gamma
SynonymsPpar-gamma2, PPAR-gamma, Nr1c3, PPARgamma, PPARgamma2
MMRRC Submission 041699-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4429 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location115360951-115490399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115440023 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 59 (M59K)
Ref Sequence ENSEMBL: ENSMUSP00000144975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000450] [ENSMUST00000171644] [ENSMUST00000203732] [ENSMUST00000204305] [ENSMUST00000205213]
Predicted Effect probably benign
Transcript: ENSMUST00000000450
AA Change: M89K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000000450
Gene: ENSMUSG00000000440
AA Change: M89K

DomainStartEndE-ValueType
Pfam:PPARgamma_N 31 108 1.1e-35 PFAM
ZnF_C4 136 206 2.61e-34 SMART
HOLI 315 474 9.89e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171644
AA Change: M59K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000131962
Gene: ENSMUSG00000000440
AA Change: M59K

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 3.1e-36 PFAM
ZnF_C4 106 176 2.61e-34 SMART
HOLI 285 444 9.89e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203732
AA Change: M59K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000145525
Gene: ENSMUSG00000000440
AA Change: M59K

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 2e-35 PFAM
ZnF_C4 106 176 2.61e-34 SMART
HOLI 285 444 9.89e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203896
Predicted Effect probably benign
Transcript: ENSMUST00000204305
AA Change: M59K

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000145083
Gene: ENSMUSG00000000440
AA Change: M59K

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 7.3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205213
AA Change: M59K

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000144975
Gene: ENSMUSG00000000440
AA Change: M59K

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 7.1e-33 PFAM
ZnF_C4 106 176 1.1e-36 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a nuclear receptor protein belonging to the peroxisome proliferator-activated receptor (Ppar) family. The encoded protein is a ligand-activated transcription factor that is involved in the regulation of adipocyte differentiation and glucose homeostasis. The encoded protein forms a heterodimer with retinoid X receptors and binds to DNA motifs termed "peroxisome proliferator response elements" to either activate or inhibit gene expression. Mice lacking the encoded protein die at an embryonic stage due to severe defects in placental vascularization. When the embryos lacking this gene are supplemented with healthy placentas, the mutants survive to term, but succumb to lipodystrophy and multiple hemorrhages. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lethality due to placental defects. Heterozygotes show greater B cell proliferation, enhanced leptin secretion, and resistance to diet-induced adipocyte hypertrophy and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abca5 T C 11: 110,311,410 T390A probably benign Het
Ahcyl2 T G 6: 29,894,875 V452G probably damaging Het
Ano4 T A 10: 88,992,942 N545I probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Catip T A 1: 74,368,732 probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cnpy3 T A 17: 46,747,144 Q111L probably benign Het
Dnah8 A G 17: 30,752,146 N2725D probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Ephb3 G A 16: 21,214,463 E66K probably damaging Het
Gm6594 T A 17: 82,539,494 D79E probably benign Het
Gtf2e2 T A 8: 33,752,493 Y74* probably null Het
Hacd4 A T 4: 88,434,947 F103I possibly damaging Het
Hap1 T C 11: 100,354,272 T38A probably benign Het
Havcr2 T A 11: 46,456,560 D72E probably damaging Het
Iqcg G A 16: 33,019,490 T362I probably benign Het
Lect2 C T 13: 56,545,725 probably null Het
Lemd3 T C 10: 120,977,988 T447A probably benign Het
Lrrc72 T C 12: 36,208,624 N78S probably damaging Het
Map3k14 A G 11: 103,227,584 L592P probably damaging Het
Meioc T C 11: 102,675,720 Y721H probably damaging Het
Mrps10 T A 17: 47,378,199 probably null Het
Myo5c A G 9: 75,294,001 Y1406C probably damaging Het
Myo7a T C 7: 98,053,188 Y2098C probably damaging Het
Nol9 C T 4: 152,041,174 T194I probably damaging Het
Nox3 G A 17: 3,682,958 T206I probably benign Het
Nsd2 T G 5: 33,843,202 M21R probably damaging Het
Pcdh9 T C 14: 93,887,384 N327S probably damaging Het
Pclo T G 5: 14,678,100 probably benign Het
Prag1 A G 8: 36,146,642 K1116R probably damaging Het
Rhbdf1 C T 11: 32,213,369 E368K probably benign Het
Rita1 A G 5: 120,609,561 V224A probably damaging Het
Rsph6a T A 7: 19,074,063 W384R probably damaging Het
Scn1a A T 2: 66,350,985 Y65N possibly damaging Het
Serpina5 C A 12: 104,103,406 F292L probably benign Het
Sf3b3 A C 8: 110,826,118 L511V probably benign Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slco6d1 T C 1: 98,496,366 V581A possibly damaging Het
Sptbn2 T C 19: 4,738,355 Y1121H probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Timm29 G C 9: 21,593,479 A148P probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Uba6 C T 5: 86,120,547 V941I probably damaging Het
Vmn1r174 T C 7: 23,754,140 V77A probably benign Het
Zfp661 A G 2: 127,578,708 V57A probably damaging Het
Zfp867 C T 11: 59,465,037 D64N possibly damaging Het
Zp3r T C 1: 130,591,391 T294A possibly damaging Het
Other mutations in Pparg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Pparg APN 6 115439861 missense probably damaging 0.99
IGL00938:Pparg APN 6 115463139 missense probably benign 0.09
IGL01303:Pparg APN 6 115472954 missense possibly damaging 0.89
IGL01454:Pparg APN 6 115439939 missense probably damaging 1.00
IGL01552:Pparg APN 6 115490122 missense probably benign 0.00
IGL02998:Pparg APN 6 115463088 missense probably benign 0.01
IGL03167:Pparg APN 6 115473227 missense probably damaging 1.00
IGL03179:Pparg APN 6 115439872 missense probably damaging 1.00
Energy UTSW 6 115451044 missense probably damaging 1.00
R1083:Pparg UTSW 6 115490146 missense probably damaging 0.99
R1569:Pparg UTSW 6 115439999 missense probably benign 0.14
R1620:Pparg UTSW 6 115473281 missense probably benign 0.01
R1850:Pparg UTSW 6 115450980 missense probably damaging 1.00
R2339:Pparg UTSW 6 115451044 missense probably damaging 1.00
R4941:Pparg UTSW 6 115490110 missense probably damaging 1.00
R4946:Pparg UTSW 6 115451028 missense probably damaging 1.00
R5110:Pparg UTSW 6 115473003 missense probably damaging 1.00
R5523:Pparg UTSW 6 115490071 missense probably damaging 1.00
R6900:Pparg UTSW 6 115472988 missense possibly damaging 0.87
X0064:Pparg UTSW 6 115439914 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCCCTCCAGAACTTGACTC -3'
(R):5'- TTCAAGCGTAGTGGATAAACTGAG -3'

Sequencing Primer
(F):5'- ATTACCATGGTTGACACAGAGATGC -3'
(R):5'- CTGAGTAAAGATGCCTTCTTGTCAG -3'
Posted On2015-07-07