Incidental Mutation 'R0038:Nlrp1b'
ID32832
Institutional Source Beutler Lab
Gene Symbol Nlrp1b
Ensembl Gene ENSMUSG00000070390
Gene NameNLR family, pyrin domain containing 1B
SynonymsNalp1b
MMRRC Submission 038332-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R0038 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location71153102-71230733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71172171 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 685 (S685P)
Ref Sequence ENSEMBL: ENSMUSP00000104156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094046] [ENSMUST00000108514] [ENSMUST00000108515] [ENSMUST00000108516] [ENSMUST00000136493]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094046
AA Change: S685P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091588
Gene: ENSMUSG00000070390
AA Change: S685P

DomainStartEndE-ValueType
Pfam:NACHT 131 300 6.7e-43 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 812 1064 8.2e-104 PFAM
Pfam:CARD 1083 1166 3.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108514
AA Change: S688P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000104154
Gene: ENSMUSG00000070390
AA Change: S688P

DomainStartEndE-ValueType
Pfam:NACHT 131 300 2.1e-40 PFAM
LRR 630 657 2.24e0 SMART
LRR 659 686 8.82e0 SMART
LRR 687 714 3.49e-5 SMART
Pfam:FIIND 814 1068 2.4e-136 PFAM
Pfam:CARD 1086 1169 3.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108515
AA Change: S688P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000104155
Gene: ENSMUSG00000070390
AA Change: S688P

DomainStartEndE-ValueType
Pfam:NACHT 131 300 6.9e-41 PFAM
LRR 630 657 2.24e0 SMART
LRR 659 686 8.82e0 SMART
LRR 687 714 3.49e-5 SMART
Pfam:FIIND 815 1067 5e-104 PFAM
Pfam:CARD 1086 1169 1e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108516
AA Change: S685P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104156
Gene: ENSMUSG00000070390
AA Change: S685P

DomainStartEndE-ValueType
Pfam:NACHT 131 300 2.2e-42 PFAM
LRR 627 654 2.24e0 SMART
LRR 656 683 8.82e0 SMART
LRR 684 711 3.49e-5 SMART
Pfam:FIIND 811 1065 3.9e-136 PFAM
Pfam:CARD 1083 1166 1.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136493
SMART Domains Protein: ENSMUSP00000121155
Gene: ENSMUSG00000070390

DomainStartEndE-ValueType
Pfam:NACHT 131 300 8.9e-43 PFAM
PDB:4IM6|A 610 662 6e-10 PDB
Blast:LRR 627 654 3e-11 BLAST
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ced-4 family of apoptosis proteins. Ced-family members contain a caspase recruitment domain (CARD) and are known to be key mediators of programmed cell death. The encoded protein contains a distinct N-terminal pyrin-like motif, which is possibly involved in protein-protein interactions. This protein interacts strongly with caspase 2 and weakly with caspase 9. Overexpression of this gene was demonstrated to induce apoptosis in cells. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection from anthrax lethal toxin-induced lung injury and pyroptosis of macrophages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,886,102 probably benign Het
Ankrd28 A T 14: 31,708,035 M892K probably damaging Het
Arhgef25 T C 10: 127,186,865 probably benign Het
Arl9 G A 5: 77,006,475 E17K probably benign Het
Bbs9 G A 9: 22,504,094 V105I probably benign Het
Celsr1 A T 15: 85,929,419 N1997K possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cldn8 A G 16: 88,563,034 M1T probably null Het
Clec11a A G 7: 44,306,482 probably benign Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Col19a1 A T 1: 24,559,744 L56Q unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2b10 G A 7: 25,914,862 A254T probably benign Het
Ddx39 T C 8: 83,722,498 L305P probably damaging Het
Depdc5 A G 5: 32,868,853 E60G probably benign Het
Eif2ak2 T A 17: 78,863,955 M340L probably benign Het
Etl4 A T 2: 20,743,574 H39L probably damaging Het
Fat3 T C 9: 15,915,010 T4549A probably damaging Het
Fbxw28 A T 9: 109,338,540 W50R probably damaging Het
Ggt7 T C 2: 155,502,781 D214G probably benign Het
Gramd1b G A 9: 40,317,526 T252M probably damaging Het
Grin1 T C 2: 25,297,459 N613S probably null Het
Hcrtr2 A T 9: 76,259,681 S125T probably benign Het
Hr T C 14: 70,568,085 L1091P probably damaging Het
Htr2a T G 14: 74,706,247 S422R probably benign Het
Ighmbp2 A G 19: 3,262,097 S886P probably damaging Het
Iqcg C A 16: 33,045,642 L110F probably benign Het
Kirrel3 T A 9: 34,911,770 probably null Het
Kremen1 A C 11: 5,207,703 probably benign Het
Lama2 T C 10: 26,986,797 D2990G probably benign Het
Lin52 C G 12: 84,529,725 L111V probably damaging Het
Myh15 T C 16: 49,071,141 probably benign Het
Ncor1 A G 11: 62,392,551 F437L probably damaging Het
Oog4 T C 4: 143,438,944 D211G probably benign Het
Oscar A G 7: 3,616,073 V2A probably benign Het
Pdzd8 A G 19: 59,299,596 I1124T possibly damaging Het
Pgm3 A T 9: 86,564,673 probably benign Het
Pnpla5 A G 15: 84,122,513 Y90H probably damaging Het
Polr1b C T 2: 129,115,668 R548* probably null Het
Ptprg T A 14: 12,213,710 M1026K probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rapgef2 T C 3: 79,069,396 I1368V probably benign Het
Rnf168 T C 16: 32,298,995 V458A probably benign Het
Rnf32 T C 5: 29,205,654 probably benign Het
Sclt1 T C 3: 41,629,508 probably benign Het
Serpina12 A G 12: 104,037,957 F139L probably damaging Het
Sos2 T G 12: 69,596,693 Q971P probably damaging Het
Stag3 T A 5: 138,301,036 probably null Het
Stard5 T C 7: 83,636,743 probably benign Het
Stard9 T A 2: 120,695,832 C857S probably benign Het
Suclg1 A G 6: 73,260,503 E77G probably benign Het
Trpm7 A G 2: 126,795,468 S204P probably damaging Het
Ush2a G T 1: 188,626,612 G2112C probably benign Het
Vmn2r15 T A 5: 109,293,144 T283S possibly damaging Het
Wdr6 A T 9: 108,572,969 V1120D probably damaging Het
Zfp644 T G 5: 106,635,043 E1155A probably benign Het
Other mutations in Nlrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Nlrp1b APN 11 71181181 intron probably benign
IGL00571:Nlrp1b APN 11 71163973 missense probably null 0.48
IGL01358:Nlrp1b APN 11 71181856 missense possibly damaging 0.91
IGL01937:Nlrp1b APN 11 71181407 missense probably damaging 0.98
IGL01945:Nlrp1b APN 11 71181407 missense probably damaging 0.98
IGL02375:Nlrp1b APN 11 71161680 missense probably damaging 1.00
IGL02552:Nlrp1b APN 11 71182052 missense possibly damaging 0.57
IGL02552:Nlrp1b APN 11 71172231 missense possibly damaging 0.96
IGL02588:Nlrp1b APN 11 71182279 nonsense probably null
IGL02833:Nlrp1b APN 11 71161172 missense probably benign
IGL02955:Nlrp1b APN 11 71169811 missense possibly damaging 0.73
IGL03002:Nlrp1b APN 11 71168859 missense probably benign 0.00
IGL03033:Nlrp1b APN 11 71161839 missense probably benign 0.22
IGL03122:Nlrp1b APN 11 71181833 missense probably benign 0.00
IGL03131:Nlrp1b APN 11 71161915 missense possibly damaging 0.82
Fangled UTSW 11 71172171 missense possibly damaging 0.94
honeydew UTSW 11 71217884 missense possibly damaging 0.93
R0001:Nlrp1b UTSW 11 71161759 missense probably damaging 1.00
R0022:Nlrp1b UTSW 11 71161929 missense possibly damaging 0.61
R0022:Nlrp1b UTSW 11 71161929 missense possibly damaging 0.61
R0038:Nlrp1b UTSW 11 71172171 missense possibly damaging 0.94
R0164:Nlrp1b UTSW 11 71164099 missense probably damaging 1.00
R0164:Nlrp1b UTSW 11 71164099 missense probably damaging 1.00
R0271:Nlrp1b UTSW 11 71161765 missense possibly damaging 0.51
R0464:Nlrp1b UTSW 11 71218244 missense probably damaging 1.00
R0504:Nlrp1b UTSW 11 71182415 missense probably damaging 0.99
R0605:Nlrp1b UTSW 11 71156179 missense possibly damaging 0.88
R0863:Nlrp1b UTSW 11 71181347 missense probably benign 0.00
R1075:Nlrp1b UTSW 11 71181686 missense probably benign 0.35
R1221:Nlrp1b UTSW 11 71181464 missense probably benign 0.07
R1501:Nlrp1b UTSW 11 71156059 missense probably damaging 1.00
R1654:Nlrp1b UTSW 11 71181298 missense probably damaging 0.99
R1671:Nlrp1b UTSW 11 71201259 missense probably benign 0.45
R1676:Nlrp1b UTSW 11 71182811 missense probably benign 0.13
R1694:Nlrp1b UTSW 11 71216855 critical splice donor site probably null
R1709:Nlrp1b UTSW 11 71201273 missense probably benign 0.11
R1770:Nlrp1b UTSW 11 71160153 missense probably benign 0.22
R1775:Nlrp1b UTSW 11 71161821 missense probably damaging 1.00
R1851:Nlrp1b UTSW 11 71182616 missense possibly damaging 0.96
R1932:Nlrp1b UTSW 11 71182138 missense probably damaging 0.96
R2063:Nlrp1b UTSW 11 71161086 missense probably benign 0.09
R2189:Nlrp1b UTSW 11 71169795 missense probably damaging 1.00
R2223:Nlrp1b UTSW 11 71155989 splice site probably benign
R2284:Nlrp1b UTSW 11 71156284 missense probably benign 0.00
R2434:Nlrp1b UTSW 11 71156726 splice site probably null
R3079:Nlrp1b UTSW 11 71217968 missense probably benign 0.27
R3775:Nlrp1b UTSW 11 71156300 splice site probably benign
R3980:Nlrp1b UTSW 11 71181611 missense possibly damaging 0.56
R4016:Nlrp1b UTSW 11 71173085 missense probably damaging 1.00
R4085:Nlrp1b UTSW 11 71161762 missense probably damaging 0.98
R4542:Nlrp1b UTSW 11 71228325 missense probably damaging 1.00
R4623:Nlrp1b UTSW 11 71161843 missense probably benign 0.00
R4726:Nlrp1b UTSW 11 71181406 missense probably benign 0.10
R4764:Nlrp1b UTSW 11 71182663 missense probably damaging 1.00
R4885:Nlrp1b UTSW 11 71217884 missense possibly damaging 0.93
R4910:Nlrp1b UTSW 11 71217277 missense probably benign 0.09
R4997:Nlrp1b UTSW 11 71218334 missense probably damaging 1.00
R5046:Nlrp1b UTSW 11 71160072 missense possibly damaging 0.95
R5126:Nlrp1b UTSW 11 71181533 missense possibly damaging 0.67
R5369:Nlrp1b UTSW 11 71181799 missense probably benign
R5388:Nlrp1b UTSW 11 71172141 missense probably damaging 1.00
R5445:Nlrp1b UTSW 11 71217875 missense probably benign 0.21
R5546:Nlrp1b UTSW 11 71217276 missense probably benign 0.04
R5567:Nlrp1b UTSW 11 71181403 missense probably benign
R5826:Nlrp1b UTSW 11 71181196 missense probably benign 0.17
R5955:Nlrp1b UTSW 11 71217865 missense probably damaging 1.00
R5995:Nlrp1b UTSW 11 71181746 missense probably damaging 1.00
R6059:Nlrp1b UTSW 11 71217010 missense possibly damaging 0.53
R6170:Nlrp1b UTSW 11 71156079 missense probably damaging 1.00
R6191:Nlrp1b UTSW 11 71218457 nonsense probably null
R6250:Nlrp1b UTSW 11 71181799 missense probably benign 0.11
R6312:Nlrp1b UTSW 11 71228397 missense probably benign 0.38
R6352:Nlrp1b UTSW 11 71181701 missense probably damaging 0.99
R6807:Nlrp1b UTSW 11 71217704 missense probably damaging 1.00
R6854:Nlrp1b UTSW 11 71228433 missense possibly damaging 0.93
R6908:Nlrp1b UTSW 11 71217296 missense probably benign
R6938:Nlrp1b UTSW 11 71218216 missense probably damaging 1.00
R7098:Nlrp1b UTSW 11 71218274 missense possibly damaging 0.89
R7142:Nlrp1b UTSW 11 71172075 nonsense probably null
R7149:Nlrp1b UTSW 11 71181656 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAAGAAGGCAATTCTGAGAGTCCC -3'
(R):5'- TGCCACGAATCACAGAGACCTGAG -3'

Sequencing Primer
(F):5'- acattccatttaatccatgaggac -3'
(R):5'- CGAATCACAGAGACCTGAGATAAG -3'
Posted On2013-05-09