Incidental Mutation 'R4429:Gtf2e2'
ID328325
Institutional Source Beutler Lab
Gene Symbol Gtf2e2
Ensembl Gene ENSMUSG00000031585
Gene Namegeneral transcription factor II E, polypeptide 2 (beta subunit)
SynonymsC330006J08Rik, 34kDa
MMRRC Submission 041699-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R4429 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location33731833-33777173 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 33752493 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 74 (Y74*)
Ref Sequence ENSEMBL: ENSMUSP00000141016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167264] [ENSMUST00000170705] [ENSMUST00000171010] [ENSMUST00000179364] [ENSMUST00000187392] [ENSMUST00000190639]
Predicted Effect probably null
Transcript: ENSMUST00000167264
AA Change: Y74*
SMART Domains Protein: ENSMUSP00000129834
Gene: ENSMUSG00000031585
AA Change: Y74*

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
Pfam:TFIIE_beta 75 146 2.3e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170705
AA Change: Y74*
SMART Domains Protein: ENSMUSP00000126284
Gene: ENSMUSG00000031585
AA Change: Y74*

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
Pfam:TFIIE_beta 73 146 1.7e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171010
AA Change: Y74*
SMART Domains Protein: ENSMUSP00000132287
Gene: ENSMUSG00000031585
AA Change: Y74*

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
Pfam:TFIIE_beta 73 146 1.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179364
SMART Domains Protein: ENSMUSP00000136891
Gene: ENSMUSG00000094500

DomainStartEndE-ValueType
Pfam:DUF4713 8 61 6.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187392
SMART Domains Protein: ENSMUSP00000141167
Gene: ENSMUSG00000031585

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190639
AA Change: Y74*
SMART Domains Protein: ENSMUSP00000141016
Gene: ENSMUSG00000031585
AA Change: Y74*

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
Pfam:TFIIE_beta 73 127 2.5e-16 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The general transcription factor IIE (TFIIE) is part of the RNA polymerase II transcription initiation complex, recruiting TFIIH and being essential for promoter clearance by RNA polymerase II. TFIIE is a heterodimer (and sometimes heterotetramer) of alpha and beta subunits. The protein encoded by this gene represents the beta subunit of TFIIE. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abca5 T C 11: 110,311,410 T390A probably benign Het
Ahcyl2 T G 6: 29,894,875 V452G probably damaging Het
Ano4 T A 10: 88,992,942 N545I probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Catip T A 1: 74,368,732 probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cnpy3 T A 17: 46,747,144 Q111L probably benign Het
Dnah8 A G 17: 30,752,146 N2725D probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Ephb3 G A 16: 21,214,463 E66K probably damaging Het
Gm6594 T A 17: 82,539,494 D79E probably benign Het
Hacd4 A T 4: 88,434,947 F103I possibly damaging Het
Hap1 T C 11: 100,354,272 T38A probably benign Het
Havcr2 T A 11: 46,456,560 D72E probably damaging Het
Iqcg G A 16: 33,019,490 T362I probably benign Het
Lect2 C T 13: 56,545,725 probably null Het
Lemd3 T C 10: 120,977,988 T447A probably benign Het
Lrrc72 T C 12: 36,208,624 N78S probably damaging Het
Map3k14 A G 11: 103,227,584 L592P probably damaging Het
Meioc T C 11: 102,675,720 Y721H probably damaging Het
Mrps10 T A 17: 47,378,199 probably null Het
Myo5c A G 9: 75,294,001 Y1406C probably damaging Het
Myo7a T C 7: 98,053,188 Y2098C probably damaging Het
Nol9 C T 4: 152,041,174 T194I probably damaging Het
Nox3 G A 17: 3,682,958 T206I probably benign Het
Nsd2 T G 5: 33,843,202 M21R probably damaging Het
Pcdh9 T C 14: 93,887,384 N327S probably damaging Het
Pclo T G 5: 14,678,100 probably benign Het
Pparg T A 6: 115,440,023 M59K probably benign Het
Prag1 A G 8: 36,146,642 K1116R probably damaging Het
Rhbdf1 C T 11: 32,213,369 E368K probably benign Het
Rita1 A G 5: 120,609,561 V224A probably damaging Het
Rsph6a T A 7: 19,074,063 W384R probably damaging Het
Scn1a A T 2: 66,350,985 Y65N possibly damaging Het
Serpina5 C A 12: 104,103,406 F292L probably benign Het
Sf3b3 A C 8: 110,826,118 L511V probably benign Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slco6d1 T C 1: 98,496,366 V581A possibly damaging Het
Sptbn2 T C 19: 4,738,355 Y1121H probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Timm29 G C 9: 21,593,479 A148P probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Uba6 C T 5: 86,120,547 V941I probably damaging Het
Vmn1r174 T C 7: 23,754,140 V77A probably benign Het
Zfp661 A G 2: 127,578,708 V57A probably damaging Het
Zfp867 C T 11: 59,465,037 D64N possibly damaging Het
Zp3r T C 1: 130,591,391 T294A possibly damaging Het
Other mutations in Gtf2e2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Gtf2e2 APN 8 33776445 splice site probably benign
IGL02154:Gtf2e2 APN 8 33755961 critical splice donor site probably null
IGL03213:Gtf2e2 APN 8 33752497 missense probably damaging 1.00
R0383:Gtf2e2 UTSW 8 33755945 missense probably damaging 1.00
R4012:Gtf2e2 UTSW 8 33755965 splice site probably benign
R5987:Gtf2e2 UTSW 8 33776052 missense probably damaging 1.00
R5987:Gtf2e2 UTSW 8 33776053 missense probably benign 0.34
R6337:Gtf2e2 UTSW 8 33776015 nonsense probably null
R6949:Gtf2e2 UTSW 8 33758698 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAATTTTGCCAAAACAAAGCAGG -3'
(R):5'- GGCTGTAAGTATTACATCTTTTAGGGC -3'

Sequencing Primer
(F):5'- TTTTGCCAAAACAAAGCAGGATAGAC -3'
(R):5'- GATCTAATTCCCCTTTAGTCCA -3'
Posted On2015-07-07