Incidental Mutation 'R4429:Ano4'
ID328331
Institutional Source Beutler Lab
Gene Symbol Ano4
Ensembl Gene ENSMUSG00000035189
Gene Nameanoctamin 4
SynonymsA330096O15Rik, Tmem16d
MMRRC Submission 041699-MU
Accession Numbers

Ncbi RefSeq: NM_178773.4; MGI: 2443344

Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4429 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location88948994-89344762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88992942 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 545 (N545I)
Ref Sequence ENSEMBL: ENSMUSP00000138193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182341] [ENSMUST00000182462] [ENSMUST00000182613] [ENSMUST00000182790]
Predicted Effect probably damaging
Transcript: ENSMUST00000182341
AA Change: N545I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138193
Gene: ENSMUSG00000035189
AA Change: N545I

DomainStartEndE-ValueType
Pfam:Anoctamin 339 922 4.8e-162 PFAM
low complexity region 932 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182462
Predicted Effect possibly damaging
Transcript: ENSMUST00000182598
AA Change: N60I

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000182613
AA Change: N510I

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138268
Gene: ENSMUSG00000035189
AA Change: N510I

DomainStartEndE-ValueType
Pfam:Anoctamin 304 887 3.6e-162 PFAM
low complexity region 897 910 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182790
AA Change: N510I

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138325
Gene: ENSMUSG00000035189
AA Change: N510I

DomainStartEndE-ValueType
Pfam:Anoctamin 304 887 3.6e-162 PFAM
low complexity region 897 910 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182888
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abca5 T C 11: 110,311,410 T390A probably benign Het
Ahcyl2 T G 6: 29,894,875 V452G probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Catip T A 1: 74,368,732 probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cnpy3 T A 17: 46,747,144 Q111L probably benign Het
Dnah8 A G 17: 30,752,146 N2725D probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Ephb3 G A 16: 21,214,463 E66K probably damaging Het
Gm6594 T A 17: 82,539,494 D79E probably benign Het
Gtf2e2 T A 8: 33,752,493 Y74* probably null Het
Hacd4 A T 4: 88,434,947 F103I possibly damaging Het
Hap1 T C 11: 100,354,272 T38A probably benign Het
Havcr2 T A 11: 46,456,560 D72E probably damaging Het
Iqcg G A 16: 33,019,490 T362I probably benign Het
Lect2 C T 13: 56,545,725 probably null Het
Lemd3 T C 10: 120,977,988 T447A probably benign Het
Lrrc72 T C 12: 36,208,624 N78S probably damaging Het
Map3k14 A G 11: 103,227,584 L592P probably damaging Het
Meioc T C 11: 102,675,720 Y721H probably damaging Het
Mrps10 T A 17: 47,378,199 probably null Het
Myo5c A G 9: 75,294,001 Y1406C probably damaging Het
Myo7a T C 7: 98,053,188 Y2098C probably damaging Het
Nol9 C T 4: 152,041,174 T194I probably damaging Het
Nox3 G A 17: 3,682,958 T206I probably benign Het
Nsd2 T G 5: 33,843,202 M21R probably damaging Het
Pcdh9 T C 14: 93,887,384 N327S probably damaging Het
Pclo T G 5: 14,678,100 probably benign Het
Pparg T A 6: 115,440,023 M59K probably benign Het
Prag1 A G 8: 36,146,642 K1116R probably damaging Het
Rhbdf1 C T 11: 32,213,369 E368K probably benign Het
Rita1 A G 5: 120,609,561 V224A probably damaging Het
Rsph6a T A 7: 19,074,063 W384R probably damaging Het
Scn1a A T 2: 66,350,985 Y65N possibly damaging Het
Serpina5 C A 12: 104,103,406 F292L probably benign Het
Sf3b3 A C 8: 110,826,118 L511V probably benign Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slco6d1 T C 1: 98,496,366 V581A possibly damaging Het
Sptbn2 T C 19: 4,738,355 Y1121H probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Timm29 G C 9: 21,593,479 A148P probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Uba6 C T 5: 86,120,547 V941I probably damaging Het
Vmn1r174 T C 7: 23,754,140 V77A probably benign Het
Zfp661 A G 2: 127,578,708 V57A probably damaging Het
Zfp867 C T 11: 59,465,037 D64N possibly damaging Het
Zp3r T C 1: 130,591,391 T294A possibly damaging Het
Other mutations in Ano4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Ano4 APN 10 88954667 missense probably damaging 1.00
IGL00916:Ano4 APN 10 88998098 missense probably benign 0.01
IGL01010:Ano4 APN 10 88960600 missense probably benign 0.14
IGL01015:Ano4 APN 10 89035099 missense probably damaging 1.00
IGL01877:Ano4 APN 10 89025070 nonsense probably null 0.00
IGL02310:Ano4 APN 10 89023878 nonsense probably null
IGL02390:Ano4 APN 10 89024981 missense possibly damaging 0.88
IGL02560:Ano4 APN 10 88978741 nonsense probably null
Dwindle UTSW 10 88983778 missense probably damaging 0.98
P0017:Ano4 UTSW 10 88981190 nonsense probably null
R0126:Ano4 UTSW 10 88952292 missense possibly damaging 0.73
R0380:Ano4 UTSW 10 88978813 missense possibly damaging 0.82
R0508:Ano4 UTSW 10 88980977 missense probably damaging 1.00
R0540:Ano4 UTSW 10 89023944 missense probably benign 0.00
R1802:Ano4 UTSW 10 88981016 missense probably damaging 1.00
R1864:Ano4 UTSW 10 88971391 missense probably damaging 1.00
R1871:Ano4 UTSW 10 88993027 missense probably damaging 1.00
R2829:Ano4 UTSW 10 89112939 missense possibly damaging 0.58
R2880:Ano4 UTSW 10 89112799 missense probably damaging 1.00
R3846:Ano4 UTSW 10 88995252 missense possibly damaging 0.93
R3904:Ano4 UTSW 10 89025005 missense probably damaging 1.00
R4006:Ano4 UTSW 10 89088263 missense probably benign 0.18
R4547:Ano4 UTSW 10 88981170 missense probably null
R4638:Ano4 UTSW 10 88954697 missense probably damaging 1.00
R4640:Ano4 UTSW 10 88954697 missense probably damaging 1.00
R4876:Ano4 UTSW 10 89112835 missense probably damaging 1.00
R5007:Ano4 UTSW 10 89112945 missense probably benign 0.26
R5104:Ano4 UTSW 10 89068112 missense possibly damaging 0.61
R5151:Ano4 UTSW 10 89112913 missense probably damaging 1.00
R5215:Ano4 UTSW 10 89317303 missense possibly damaging 0.86
R5396:Ano4 UTSW 10 89112840 missense probably damaging 1.00
R5826:Ano4 UTSW 10 88952327 missense probably damaging 1.00
R6018:Ano4 UTSW 10 89029266 missense probably benign 0.01
R6036:Ano4 UTSW 10 88982265 missense possibly damaging 0.95
R6036:Ano4 UTSW 10 88982265 missense possibly damaging 0.95
R6037:Ano4 UTSW 10 89317246 missense possibly damaging 0.93
R6037:Ano4 UTSW 10 89317246 missense possibly damaging 0.93
R6222:Ano4 UTSW 10 89027222 missense probably damaging 1.00
R6387:Ano4 UTSW 10 88971405 nonsense probably null
R6521:Ano4 UTSW 10 88983778 missense probably damaging 0.98
R6739:Ano4 UTSW 10 89027252 missense probably damaging 1.00
R6786:Ano4 UTSW 10 88992870 splice site probably null
T0970:Ano4 UTSW 10 88981190 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGTGCTTCATCACAGATCGTC -3'
(R):5'- GGAAAGTGCACTCTTGTGGG -3'

Sequencing Primer
(F):5'- CAGATCGTCTGCCTTGACTG -3'
(R):5'- TCTGGAAGCAGCAGCAC -3'
Posted On2015-07-07