Incidental Mutation 'R4429:Trhde'
ID328332
Institutional Source Beutler Lab
Gene Symbol Trhde
Ensembl Gene ENSMUSG00000050663
Gene NameTRH-degrading enzyme
Synonyms
MMRRC Submission 041699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R4429 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location114398823-114802307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114503123 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 594 (L594Q)
Ref Sequence ENSEMBL: ENSMUSP00000057449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061632]
Predicted Effect probably damaging
Transcript: ENSMUST00000061632
AA Change: L594Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057449
Gene: ENSMUSG00000050663
AA Change: L594Q

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
Pfam:Peptidase_M1 141 531 2.6e-141 PFAM
Pfam:ERAP1_C 679 1004 5.7e-65 PFAM
Meta Mutation Damage Score 0.0244 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase M1 family. The encoded protein is an extracellular peptidase that specifically cleaves and inactivates the neuropeptide thyrotropin-releasing hormone.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abca5 T C 11: 110,311,410 T390A probably benign Het
Ahcyl2 T G 6: 29,894,875 V452G probably damaging Het
Ano4 T A 10: 88,992,942 N545I probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Catip T A 1: 74,368,732 probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cnpy3 T A 17: 46,747,144 Q111L probably benign Het
Dnah8 A G 17: 30,752,146 N2725D probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Ephb3 G A 16: 21,214,463 E66K probably damaging Het
Gm6594 T A 17: 82,539,494 D79E probably benign Het
Gtf2e2 T A 8: 33,752,493 Y74* probably null Het
Hacd4 A T 4: 88,434,947 F103I possibly damaging Het
Hap1 T C 11: 100,354,272 T38A probably benign Het
Havcr2 T A 11: 46,456,560 D72E probably damaging Het
Iqcg G A 16: 33,019,490 T362I probably benign Het
Lect2 C T 13: 56,545,725 probably null Het
Lemd3 T C 10: 120,977,988 T447A probably benign Het
Lrrc72 T C 12: 36,208,624 N78S probably damaging Het
Map3k14 A G 11: 103,227,584 L592P probably damaging Het
Meioc T C 11: 102,675,720 Y721H probably damaging Het
Mrps10 T A 17: 47,378,199 probably null Het
Myo5c A G 9: 75,294,001 Y1406C probably damaging Het
Myo7a T C 7: 98,053,188 Y2098C probably damaging Het
Nol9 C T 4: 152,041,174 T194I probably damaging Het
Nox3 G A 17: 3,682,958 T206I probably benign Het
Nsd2 T G 5: 33,843,202 M21R probably damaging Het
Pcdh9 T C 14: 93,887,384 N327S probably damaging Het
Pclo T G 5: 14,678,100 probably benign Het
Pparg T A 6: 115,440,023 M59K probably benign Het
Prag1 A G 8: 36,146,642 K1116R probably damaging Het
Rhbdf1 C T 11: 32,213,369 E368K probably benign Het
Rita1 A G 5: 120,609,561 V224A probably damaging Het
Rsph6a T A 7: 19,074,063 W384R probably damaging Het
Scn1a A T 2: 66,350,985 Y65N possibly damaging Het
Serpina5 C A 12: 104,103,406 F292L probably benign Het
Sf3b3 A C 8: 110,826,118 L511V probably benign Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slco6d1 T C 1: 98,496,366 V581A possibly damaging Het
Sptbn2 T C 19: 4,738,355 Y1121H probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Timm29 G C 9: 21,593,479 A148P probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Uba6 C T 5: 86,120,547 V941I probably damaging Het
Vmn1r174 T C 7: 23,754,140 V77A probably benign Het
Zfp661 A G 2: 127,578,708 V57A probably damaging Het
Zfp867 C T 11: 59,465,037 D64N possibly damaging Het
Zp3r T C 1: 130,591,391 T294A possibly damaging Het
Other mutations in Trhde
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Trhde APN 10 114486747 missense possibly damaging 0.77
IGL00516:Trhde APN 10 114446199 missense probably benign 0.01
IGL01371:Trhde APN 10 114588500 missense possibly damaging 0.57
IGL01488:Trhde APN 10 114446158 missense possibly damaging 0.58
IGL01602:Trhde APN 10 114787943 missense probably benign
IGL01605:Trhde APN 10 114787943 missense probably benign
IGL02150:Trhde APN 10 114592108 missense probably damaging 1.00
IGL02165:Trhde APN 10 114592161 missense probably damaging 1.00
IGL02340:Trhde APN 10 114592213 splice site probably benign
IGL02412:Trhde APN 10 114486925 missense probably damaging 1.00
IGL02421:Trhde APN 10 114412461 missense probably damaging 1.00
IGL02496:Trhde APN 10 114800561 nonsense probably null
IGL02952:Trhde APN 10 114800573 missense probably damaging 0.99
IGL03197:Trhde APN 10 114413308 missense probably benign 0.00
l3-37 UTSW 10 114801081 missense probably benign
R0360:Trhde UTSW 10 114502982 splice site probably benign
R0364:Trhde UTSW 10 114502982 splice site probably benign
R0457:Trhde UTSW 10 114448262 missense probably benign 0.37
R0589:Trhde UTSW 10 114448324 missense probably benign 0.01
R1132:Trhde UTSW 10 114412478 missense possibly damaging 0.86
R1288:Trhde UTSW 10 114801290 missense probably benign 0.37
R1569:Trhde UTSW 10 114446188 missense possibly damaging 0.78
R1776:Trhde UTSW 10 114800603 missense probably benign 0.06
R1781:Trhde UTSW 10 114588500 missense possibly damaging 0.57
R1927:Trhde UTSW 10 114800849 missense probably damaging 1.00
R1976:Trhde UTSW 10 114588431 missense possibly damaging 0.57
R2011:Trhde UTSW 10 114498793 missense probably benign 0.02
R2332:Trhde UTSW 10 114592165 missense probably damaging 1.00
R2356:Trhde UTSW 10 114401516 missense probably damaging 1.00
R3107:Trhde UTSW 10 114592066 missense probably damaging 1.00
R3108:Trhde UTSW 10 114592066 missense probably damaging 1.00
R3907:Trhde UTSW 10 114800696 missense possibly damaging 0.72
R4067:Trhde UTSW 10 114444680 nonsense probably null
R4214:Trhde UTSW 10 114788070 missense possibly damaging 0.51
R4428:Trhde UTSW 10 114503123 missense probably damaging 1.00
R4430:Trhde UTSW 10 114503123 missense probably damaging 1.00
R5244:Trhde UTSW 10 114801081 missense probably benign
R5456:Trhde UTSW 10 114486760 missense possibly damaging 0.58
R5540:Trhde UTSW 10 114800592 missense probably benign 0.45
R5699:Trhde UTSW 10 114588502 missense probably benign 0.00
R5967:Trhde UTSW 10 114567134 missense probably damaging 1.00
R6326:Trhde UTSW 10 114567224 missense probably damaging 1.00
R6467:Trhde UTSW 10 114504198 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGGATTAAAACAGTGGTCCAC -3'
(R):5'- AACCATATAAGACTCTCGAGGC -3'

Sequencing Primer
(F):5'- ACAGTGGTCCACATATATTTTAGAAC -3'
(R):5'- ACTCTCGAGGCAAAAATTAATTTTAC -3'
Posted On2015-07-07