Incidental Mutation 'R4429:Map3k14'
ID328340
Institutional Source Beutler Lab
Gene Symbol Map3k14
Ensembl Gene ENSMUSG00000020941
Gene Namemitogen-activated protein kinase kinase kinase 14
SynonymsNik
MMRRC Submission 041699-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R4429 (G1)
Quality Score170
Status Not validated
Chromosome11
Chromosomal Location103219762-103267472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103227584 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 592 (L592P)
Ref Sequence ENSEMBL: ENSMUSP00000021324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021324]
PDB Structure
Crystal structure of apo murine Nf-kappaB inducing kinase (NIK) [X-RAY DIFFRACTION]
Crystal structure of murine NF-kappaB inducing kinase (NIK) bound to a 6-alkynylindoline (cmp1) [X-RAY DIFFRACTION]
Crystal structure of murine NF-kappaB inducing kinase (NIK) bound to a 2-(aminothiazoly)phenol (cmp2) [X-RAY DIFFRACTION]
Crystal structure of murine NF-kappaB inducing kinase (NIK) V408L bound to a 2-(aminothiazolyl)phenol (cmp3) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000021324
AA Change: L592P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021324
Gene: ENSMUSG00000020941
AA Change: L592P

DomainStartEndE-ValueType
low complexity region 134 153 N/A INTRINSIC
Pfam:Pkinase 402 653 2.1e-42 PFAM
Pfam:Pkinase_Tyr 402 653 1.5e-24 PFAM
low complexity region 706 719 N/A INTRINSIC
low complexity region 760 774 N/A INTRINSIC
low complexity region 789 804 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype Homozygotes for a spontaneous mutation exhibit deficiencies in cellular and humoral immunity, susceptibility to infections, absence of lymph nodes and Peyer's patches, failure of isotype switching, and inflammation of exocrine organs.
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 G306V unknown Het
1810026J23Rik G C 9: 21,593,479 A148P probably damaging Het
Abca5 T C 11: 110,311,410 T390A probably benign Het
Ahcyl2 T G 6: 29,894,875 V452G probably damaging Het
Ano4 T A 10: 88,992,942 N545I probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Catip T A 1: 74,368,732 Y408N unknown Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cnpy3 T A 17: 46,747,144 Q111L probably benign Het
D8Ertd82e A G 8: 36,146,642 K1116R probably damaging Het
Dnah8 A G 17: 30,752,146 N2725D probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Ephb3 G A 16: 21,214,463 E100K probably damaging Het
Gm6594 T A 17: 82,539,494 D79E probably benign Het
Gtf2e2 T A 8: 33,752,493 Y74* probably null Het
Hacd4 A T 4: 88,434,947 F103I possibly damaging Het
Hap1 T C 11: 100,354,272 T186A probably benign Het
Havcr2 T A 11: 46,456,560 D72E probably damaging Het
Iqcg G A 16: 33,019,490 T362I probably benign Het
Lect2 C T 13: 56,545,725 probably null Het
Lemd3 T C 10: 120,977,988 T447A probably benign Het
Lrrc72 T C 12: 36,208,624 N78S probably damaging Het
Meioc T C 11: 102,675,720 Y721H probably damaging Het
Mrps10 T A 17: 47,378,199 probably null Het
Myo5c A G 9: 75,294,001 Y1406C probably damaging Het
Myo7a T C 7: 98,053,188 Y2098C probably damaging Het
Nol9 C T 4: 152,041,174 T194I probably damaging Het
Nox3 G A 17: 3,682,958 T206I probably benign Het
Pcdh9 T C 14: 93,887,384 N327S probably damaging Het
Pclo T G 5: 14,678,100 F2324C unknown Het
Pparg T A 6: 115,440,023 M59K probably benign Het
Rhbdf1 C T 11: 32,213,369 E368K probably benign Het
Rita1 A G 5: 120,609,561 V224A probably damaging Het
Rsph6a T A 7: 19,074,063 W639R probably damaging Het
Scn1a A T 2: 66,350,985 Y65N probably damaging Het
Serpina5 C A 12: 104,103,406 F292L probably benign Het
Sf3b3 A C 8: 110,826,118 L511V probably benign Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slco6d1 T C 1: 98,496,366 V581A possibly damaging Het
Sptbn2 T C 19: 4,738,355 Y1121H probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Uba6 C T 5: 86,120,547 V941I probably damaging Het
Vmn1r174 T C 7: 23,754,140 V77A probably benign Het
Whsc1 T G 5: 33,843,202 M21R probably damaging Het
Zfp661 A G 2: 127,578,708 V57A probably damaging Het
Zfp867 C T 11: 59,465,037 D64N possibly damaging Het
Zp3r T C 1: 130,591,391 T294A possibly damaging Het
Other mutations in Map3k14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Map3k14 APN 11 103227579 missense probably damaging 1.00
IGL00590:Map3k14 APN 11 103237554 missense probably damaging 1.00
IGL03065:Map3k14 APN 11 103225101 missense probably damaging 1.00
lucky UTSW 11 103249558 nonsense
R0020:Map3k14 UTSW 11 103227674 missense probably damaging 0.99
R0070:Map3k14 UTSW 11 103239554 critical splice acceptor site probably null
R0294:Map3k14 UTSW 11 103227137 missense possibly damaging 0.80
R0624:Map3k14 UTSW 11 103242291 missense possibly damaging 0.77
R0734:Map3k14 UTSW 11 103227000 missense probably benign 0.00
R1015:Map3k14 UTSW 11 103225300 missense probably damaging 1.00
R1170:Map3k14 UTSW 11 103238917 splice site noncoding transcript
R1487:Map3k14 UTSW 11 103225337 missense possibly damaging 0.48
R2204:Map3k14 UTSW 11 103239454 missense possibly damaging 0.82
R2880:Map3k14 UTSW 11 103221032 missense probably damaging 1.00
R4624:Map3k14 UTSW 11 103231101 missense probably damaging 1.00
R4967:Map3k14 UTSW 11 103239531 missense probably benign 0.00
R5098:Map3k14 UTSW 11 103224359 missense probably damaging 1.00
R5148:Map3k14 UTSW 11 103239332 missense probably benign
R5208:Map3k14 UTSW 11 103239146 missense probably damaging 0.98
R5480:Map3k14 UTSW 11 103239504 missense probably benign 0.03
T0970:Map3k14 UTSW 11 103224298 nonsense probably null
X0023:Map3k14 UTSW 11 103239822 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCCAGACTTAGTCTAAAGGATGC -3'
(R):5'- GCAGCCCAGGAACTAAGTTG -3'

Sequencing Primer
(F):5'- CTTAGTCTAAAGGATGCTGGGAG -3'
(R):5'- ACTAAGTTGAGTGGGCACTGAATTC -3'
Posted OnJul 07, 2015