Incidental Mutation 'R4429:Abca5'
ID328341
Institutional Source Beutler Lab
Gene Symbol Abca5
Ensembl Gene ENSMUSG00000018800
Gene NameATP-binding cassette, sub-family A (ABC1), member 5
SynonymsABC13, B930033A02Rik
MMRRC Submission 041699-MU
Accession Numbers

NCBI RefSeq: NM_147219.2; MGI: 2386607

Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R4429 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location110269369-110337716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110311410 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 390 (T390A)
Ref Sequence ENSEMBL: ENSMUSP00000120708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043961] [ENSMUST00000124714]
Predicted Effect probably benign
Transcript: ENSMUST00000043961
AA Change: T390A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000047927
Gene: ENSMUSG00000018800
AA Change: T390A

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 29 416 4.3e-33 PFAM
AAA 506 691 2.88e-8 SMART
low complexity region 733 744 N/A INTRINSIC
transmembrane domain 864 886 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
low complexity region 1262 1267 N/A INTRINSIC
AAA 1325 1512 3.52e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124714
AA Change: T390A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000120708
Gene: ENSMUSG00000018800
AA Change: T390A

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 30 416 9.5e-32 PFAM
AAA 506 691 2.88e-8 SMART
low complexity region 733 744 N/A INTRINSIC
transmembrane domain 864 886 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
transmembrane domain 1019 1041 N/A INTRINSIC
transmembrane domain 1074 1096 N/A INTRINSIC
transmembrane domain 1103 1125 N/A INTRINSIC
transmembrane domain 1136 1158 N/A INTRINSIC
transmembrane domain 1165 1187 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127318
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype Strain: 3581814
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24, but neither the substrate nor the function of this gene is known. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit exophthalmos, tremors and collapse of the thyroid gland, and develop a dilated cardiomyopathy with large thrombi due to depression of the cardiac function. Severe edema, liver injury and premature death appear to be sensitive to genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Ahcyl2 T G 6: 29,894,875 V452G probably damaging Het
Ano4 T A 10: 88,992,942 N545I probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Catip T A 1: 74,368,732 probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cnpy3 T A 17: 46,747,144 Q111L probably benign Het
Dnah8 A G 17: 30,752,146 N2725D probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Ephb3 G A 16: 21,214,463 E66K probably damaging Het
Gm6594 T A 17: 82,539,494 D79E probably benign Het
Gtf2e2 T A 8: 33,752,493 Y74* probably null Het
Hacd4 A T 4: 88,434,947 F103I possibly damaging Het
Hap1 T C 11: 100,354,272 T38A probably benign Het
Havcr2 T A 11: 46,456,560 D72E probably damaging Het
Iqcg G A 16: 33,019,490 T362I probably benign Het
Lect2 C T 13: 56,545,725 probably null Het
Lemd3 T C 10: 120,977,988 T447A probably benign Het
Lrrc72 T C 12: 36,208,624 N78S probably damaging Het
Map3k14 A G 11: 103,227,584 L592P probably damaging Het
Meioc T C 11: 102,675,720 Y721H probably damaging Het
Mrps10 T A 17: 47,378,199 probably null Het
Myo5c A G 9: 75,294,001 Y1406C probably damaging Het
Myo7a T C 7: 98,053,188 Y2098C probably damaging Het
Nol9 C T 4: 152,041,174 T194I probably damaging Het
Nox3 G A 17: 3,682,958 T206I probably benign Het
Nsd2 T G 5: 33,843,202 M21R probably damaging Het
Pcdh9 T C 14: 93,887,384 N327S probably damaging Het
Pclo T G 5: 14,678,100 probably benign Het
Pparg T A 6: 115,440,023 M59K probably benign Het
Prag1 A G 8: 36,146,642 K1116R probably damaging Het
Rhbdf1 C T 11: 32,213,369 E368K probably benign Het
Rita1 A G 5: 120,609,561 V224A probably damaging Het
Rsph6a T A 7: 19,074,063 W384R probably damaging Het
Scn1a A T 2: 66,350,985 Y65N possibly damaging Het
Serpina5 C A 12: 104,103,406 F292L probably benign Het
Sf3b3 A C 8: 110,826,118 L511V probably benign Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slco6d1 T C 1: 98,496,366 V581A possibly damaging Het
Sptbn2 T C 19: 4,738,355 Y1121H probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Timm29 G C 9: 21,593,479 A148P probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Uba6 C T 5: 86,120,547 V941I probably damaging Het
Vmn1r174 T C 7: 23,754,140 V77A probably benign Het
Zfp661 A G 2: 127,578,708 V57A probably damaging Het
Zfp867 C T 11: 59,465,037 D64N possibly damaging Het
Zp3r T C 1: 130,591,391 T294A possibly damaging Het
Other mutations in Abca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Abca5 APN 11 110309450 critical splice acceptor site probably null
IGL00675:Abca5 APN 11 110304985 missense probably damaging 1.00
IGL01512:Abca5 APN 11 110317823 missense probably benign 0.40
IGL01559:Abca5 APN 11 110272526 missense probably benign
IGL01584:Abca5 APN 11 110304923 missense probably damaging 0.98
IGL01604:Abca5 APN 11 110277636 missense possibly damaging 0.47
IGL01828:Abca5 APN 11 110287695 missense probably benign
IGL01880:Abca5 APN 11 110293263 missense probably benign 0.01
IGL02054:Abca5 APN 11 110292123 missense probably damaging 0.99
IGL02074:Abca5 APN 11 110293350 missense probably benign 0.00
IGL02233:Abca5 APN 11 110274344 nonsense probably null
IGL02245:Abca5 APN 11 110298169 nonsense probably null
IGL02317:Abca5 APN 11 110327761 missense probably benign 0.09
IGL02352:Abca5 APN 11 110275330 missense probably benign 0.01
IGL02359:Abca5 APN 11 110275330 missense probably benign 0.01
IGL02390:Abca5 APN 11 110296551 missense probably benign
IGL02600:Abca5 APN 11 110309438 missense probably benign 0.02
IGL02639:Abca5 APN 11 110288073 missense possibly damaging 0.79
IGL03000:Abca5 APN 11 110317814 missense probably benign 0.04
IGL03074:Abca5 APN 11 110310275 missense probably benign 0.01
IGL03078:Abca5 APN 11 110276545 nonsense probably null
IGL03342:Abca5 APN 11 110287691 missense possibly damaging 0.94
IGL03368:Abca5 APN 11 110313522 splice site probably benign
atles UTSW 11 110299929 missense probably damaging 0.99
R0106:Abca5 UTSW 11 110319825 missense probably damaging 1.00
R0116:Abca5 UTSW 11 110276505 missense probably damaging 1.00
R0305:Abca5 UTSW 11 110273311 splice site probably benign
R0550:Abca5 UTSW 11 110293840 missense probably damaging 1.00
R0578:Abca5 UTSW 11 110276489 nonsense probably null
R0587:Abca5 UTSW 11 110311377 missense probably benign 0.00
R0610:Abca5 UTSW 11 110301527 missense probably benign 0.00
R0617:Abca5 UTSW 11 110279689 missense probably damaging 0.98
R0667:Abca5 UTSW 11 110327811 missense probably benign 0.00
R0844:Abca5 UTSW 11 110319832 missense probably benign 0.00
R1273:Abca5 UTSW 11 110326665 missense probably benign 0.01
R1463:Abca5 UTSW 11 110314558 missense probably damaging 1.00
R1511:Abca5 UTSW 11 110299978 missense probably damaging 1.00
R1511:Abca5 UTSW 11 110299986 missense possibly damaging 0.73
R1687:Abca5 UTSW 11 110293888 missense probably benign 0.32
R1759:Abca5 UTSW 11 110293848 missense probably benign
R1870:Abca5 UTSW 11 110329217 missense probably benign 0.33
R2006:Abca5 UTSW 11 110313449 missense probably benign
R2039:Abca5 UTSW 11 110299929 missense probably damaging 0.99
R2076:Abca5 UTSW 11 110287652 missense probably benign 0.10
R2136:Abca5 UTSW 11 110319832 missense probably benign 0.00
R2154:Abca5 UTSW 11 110292174 missense probably benign 0.00
R2273:Abca5 UTSW 11 110275281 missense possibly damaging 0.93
R2274:Abca5 UTSW 11 110275281 missense possibly damaging 0.93
R2275:Abca5 UTSW 11 110275281 missense possibly damaging 0.93
R2328:Abca5 UTSW 11 110276521 missense probably damaging 0.99
R3702:Abca5 UTSW 11 110288058 splice site probably null
R3768:Abca5 UTSW 11 110313391 missense probably benign 0.01
R3872:Abca5 UTSW 11 110310233 missense probably damaging 1.00
R3873:Abca5 UTSW 11 110310233 missense probably damaging 1.00
R3874:Abca5 UTSW 11 110310233 missense probably damaging 1.00
R3875:Abca5 UTSW 11 110310233 missense probably damaging 1.00
R4347:Abca5 UTSW 11 110299968 missense probably damaging 1.00
R4790:Abca5 UTSW 11 110311410 missense possibly damaging 0.63
R4812:Abca5 UTSW 11 110301821 missense probably damaging 1.00
R4833:Abca5 UTSW 11 110279316 missense probably benign 0.00
R4883:Abca5 UTSW 11 110326631 missense probably damaging 1.00
R5000:Abca5 UTSW 11 110310224 missense probably damaging 1.00
R5004:Abca5 UTSW 11 110279376 missense probably damaging 0.99
R5066:Abca5 UTSW 11 110309350 intron probably benign
R5230:Abca5 UTSW 11 110319860 missense probably benign
R5321:Abca5 UTSW 11 110327825 missense probably benign
R5350:Abca5 UTSW 11 110319796 nonsense probably null
R5414:Abca5 UTSW 11 110314622 missense probably damaging 1.00
R5437:Abca5 UTSW 11 110319796 nonsense probably null
R5451:Abca5 UTSW 11 110319796 nonsense probably null
R5453:Abca5 UTSW 11 110319796 nonsense probably null
R5488:Abca5 UTSW 11 110292183 missense probably benign 0.00
R5636:Abca5 UTSW 11 110301536 missense probably benign 0.00
R5805:Abca5 UTSW 11 110279390 missense probably benign 0.06
R5900:Abca5 UTSW 11 110279156 missense possibly damaging 0.92
R6152:Abca5 UTSW 11 110313361 missense probably damaging 1.00
R6167:Abca5 UTSW 11 110292105 missense probably benign 0.10
R6343:Abca5 UTSW 11 110314552 missense probably damaging 1.00
R6425:Abca5 UTSW 11 110329232 missense possibly damaging 0.75
R6493:Abca5 UTSW 11 110293878 missense probably benign 0.00
R6498:Abca5 UTSW 11 110292102 missense possibly damaging 0.70
R6884:Abca5 UTSW 11 110329217 missense probably damaging 0.96
R6912:Abca5 UTSW 11 110306280 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GTGCTGTAAAATACTCTGGCTAGGAG -3'
(R):5'- CTTACGAAGCACCAACTGGG -3'

Sequencing Primer
(F):5'- CTCTGGCTAGGAGAAAAATTAAGTTG -3'
(R):5'- CCTGGTCTACATAGAGAGATCCTG -3'
Posted On2015-07-07