Incidental Mutation 'R4429:Cldn8'
ID328348
Institutional Source Beutler Lab
Gene Symbol Cldn8
Ensembl Gene ENSMUSG00000050520
Gene Nameclaudin 8
Synonyms
MMRRC Submission 041699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R4429 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location88560828-88563183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 88562731 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 102 (M102R)
Ref Sequence ENSEMBL: ENSMUSP00000051887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049697]
Predicted Effect probably damaging
Transcript: ENSMUST00000049697
AA Change: M102R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051887
Gene: ENSMUSG00000050520
AA Change: M102R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 2.9e-32 PFAM
Pfam:Claudin_2 15 184 5.6e-10 PFAM
Meta Mutation Damage Score 0.328 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This intronless gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a paracellular cation barrier. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abca5 T C 11: 110,311,410 T390A probably benign Het
Ahcyl2 T G 6: 29,894,875 V452G probably damaging Het
Ano4 T A 10: 88,992,942 N545I probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Catip T A 1: 74,368,732 probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cnpy3 T A 17: 46,747,144 Q111L probably benign Het
Dnah8 A G 17: 30,752,146 N2725D probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Ephb3 G A 16: 21,214,463 E66K probably damaging Het
Gm6594 T A 17: 82,539,494 D79E probably benign Het
Gtf2e2 T A 8: 33,752,493 Y74* probably null Het
Hacd4 A T 4: 88,434,947 F103I possibly damaging Het
Hap1 T C 11: 100,354,272 T38A probably benign Het
Havcr2 T A 11: 46,456,560 D72E probably damaging Het
Iqcg G A 16: 33,019,490 T362I probably benign Het
Lect2 C T 13: 56,545,725 probably null Het
Lemd3 T C 10: 120,977,988 T447A probably benign Het
Lrrc72 T C 12: 36,208,624 N78S probably damaging Het
Map3k14 A G 11: 103,227,584 L592P probably damaging Het
Meioc T C 11: 102,675,720 Y721H probably damaging Het
Mrps10 T A 17: 47,378,199 probably null Het
Myo5c A G 9: 75,294,001 Y1406C probably damaging Het
Myo7a T C 7: 98,053,188 Y2098C probably damaging Het
Nol9 C T 4: 152,041,174 T194I probably damaging Het
Nox3 G A 17: 3,682,958 T206I probably benign Het
Nsd2 T G 5: 33,843,202 M21R probably damaging Het
Pcdh9 T C 14: 93,887,384 N327S probably damaging Het
Pclo T G 5: 14,678,100 probably benign Het
Pparg T A 6: 115,440,023 M59K probably benign Het
Prag1 A G 8: 36,146,642 K1116R probably damaging Het
Rhbdf1 C T 11: 32,213,369 E368K probably benign Het
Rita1 A G 5: 120,609,561 V224A probably damaging Het
Rsph6a T A 7: 19,074,063 W384R probably damaging Het
Scn1a A T 2: 66,350,985 Y65N possibly damaging Het
Serpina5 C A 12: 104,103,406 F292L probably benign Het
Sf3b3 A C 8: 110,826,118 L511V probably benign Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slco6d1 T C 1: 98,496,366 V581A possibly damaging Het
Sptbn2 T C 19: 4,738,355 Y1121H probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Timm29 G C 9: 21,593,479 A148P probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Uba6 C T 5: 86,120,547 V941I probably damaging Het
Vmn1r174 T C 7: 23,754,140 V77A probably benign Het
Zfp661 A G 2: 127,578,708 V57A probably damaging Het
Zfp867 C T 11: 59,465,037 D64N possibly damaging Het
Zp3r T C 1: 130,591,391 T294A possibly damaging Het
Other mutations in Cldn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02888:Cldn8 APN 16 88562383 missense probably benign 0.00
R0038:Cldn8 UTSW 16 88563034 start codon destroyed probably null 1.00
R0038:Cldn8 UTSW 16 88563034 start codon destroyed probably null 1.00
R0332:Cldn8 UTSW 16 88562358 synonymous silent
R0690:Cldn8 UTSW 16 88562639 missense probably damaging 1.00
R1496:Cldn8 UTSW 16 88562401 missense probably benign
R1832:Cldn8 UTSW 16 88562858 missense probably benign 0.07
R3052:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R3053:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4428:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4430:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4431:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4465:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4485:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4659:Cldn8 UTSW 16 88562408 missense probably benign
R4660:Cldn8 UTSW 16 88562408 missense probably benign
R4662:Cldn8 UTSW 16 88562408 missense probably benign
R4679:Cldn8 UTSW 16 88562408 missense probably benign
R4741:Cldn8 UTSW 16 88562408 missense probably benign
R6590:Cldn8 UTSW 16 88562535 missense possibly damaging 0.73
R6691:Cldn8 UTSW 16 88562535 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CTGTGGTCCAGCCTATGTAGAG -3'
(R):5'- AACATTGTGGTGTTTGAGAACC -3'

Sequencing Primer
(F):5'- CAGCCTATGTAGAGGGCTTCTC -3'
(R):5'- AACCGCTGGGAAGGCTTG -3'
Posted On2015-07-07