Incidental Mutation 'R4429:Tmem181a'
ID328350
Institutional Source Beutler Lab
Gene Symbol Tmem181a
Ensembl Gene ENSMUSG00000038141
Gene Nametransmembrane protein 181A
SynonymsTmem181, 5930418K15Rik, Gpr178, C76977
MMRRC Submission 041699-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.474) question?
Stock #R4429 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location6256860-6308314 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6295786 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 185 (L185H)
Ref Sequence ENSEMBL: ENSMUSP00000086333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088940] [ENSMUST00000232383]
Predicted Effect probably damaging
Transcript: ENSMUST00000088940
AA Change: L185H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000086333
Gene: ENSMUSG00000038141
AA Change: L185H

DomainStartEndE-ValueType
transmembrane domain 17 36 N/A INTRINSIC
Pfam:MIG-14_Wnt-bd 127 422 1e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231593
Predicted Effect probably damaging
Transcript: ENSMUST00000232383
AA Change: L226H

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The TMEM181 gene encodes a putative G protein-coupled receptor expressed on the cell surface (Carette et al., 2009 [PubMed 19965467]; Wollscheid et al., 2009 [PubMed 19349973]).[supplied by OMIM, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abca5 T C 11: 110,311,410 T390A probably benign Het
Ahcyl2 T G 6: 29,894,875 V452G probably damaging Het
Ano4 T A 10: 88,992,942 N545I probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Catip T A 1: 74,368,732 probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Cnpy3 T A 17: 46,747,144 Q111L probably benign Het
Dnah8 A G 17: 30,752,146 N2725D probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Ephb3 G A 16: 21,214,463 E66K probably damaging Het
Gm6594 T A 17: 82,539,494 D79E probably benign Het
Gtf2e2 T A 8: 33,752,493 Y74* probably null Het
Hacd4 A T 4: 88,434,947 F103I possibly damaging Het
Hap1 T C 11: 100,354,272 T38A probably benign Het
Havcr2 T A 11: 46,456,560 D72E probably damaging Het
Iqcg G A 16: 33,019,490 T362I probably benign Het
Lect2 C T 13: 56,545,725 probably null Het
Lemd3 T C 10: 120,977,988 T447A probably benign Het
Lrrc72 T C 12: 36,208,624 N78S probably damaging Het
Map3k14 A G 11: 103,227,584 L592P probably damaging Het
Meioc T C 11: 102,675,720 Y721H probably damaging Het
Mrps10 T A 17: 47,378,199 probably null Het
Myo5c A G 9: 75,294,001 Y1406C probably damaging Het
Myo7a T C 7: 98,053,188 Y2098C probably damaging Het
Nol9 C T 4: 152,041,174 T194I probably damaging Het
Nox3 G A 17: 3,682,958 T206I probably benign Het
Nsd2 T G 5: 33,843,202 M21R probably damaging Het
Pcdh9 T C 14: 93,887,384 N327S probably damaging Het
Pclo T G 5: 14,678,100 probably benign Het
Pparg T A 6: 115,440,023 M59K probably benign Het
Prag1 A G 8: 36,146,642 K1116R probably damaging Het
Rhbdf1 C T 11: 32,213,369 E368K probably benign Het
Rita1 A G 5: 120,609,561 V224A probably damaging Het
Rsph6a T A 7: 19,074,063 W384R probably damaging Het
Scn1a A T 2: 66,350,985 Y65N possibly damaging Het
Serpina5 C A 12: 104,103,406 F292L probably benign Het
Sf3b3 A C 8: 110,826,118 L511V probably benign Het
Siglecg C T 7: 43,417,926 P639L possibly damaging Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slco6d1 T C 1: 98,496,366 V581A possibly damaging Het
Sptbn2 T C 19: 4,738,355 Y1121H probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Timm29 G C 9: 21,593,479 A148P probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Uba6 C T 5: 86,120,547 V941I probably damaging Het
Vmn1r174 T C 7: 23,754,140 V77A probably benign Het
Zfp661 A G 2: 127,578,708 V57A probably damaging Het
Zfp867 C T 11: 59,465,037 D64N possibly damaging Het
Zp3r T C 1: 130,591,391 T294A possibly damaging Het
Other mutations in Tmem181a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02071:Tmem181a APN 17 6297256 missense probably damaging 1.00
IGL03027:Tmem181a APN 17 6298219 missense probably damaging 1.00
R1966:Tmem181a UTSW 17 6303226 missense probably benign
R2139:Tmem181a UTSW 17 6298206 missense probably damaging 1.00
R2323:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R2324:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3001:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3002:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3003:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3034:Tmem181a UTSW 17 6280626 missense possibly damaging 0.50
R3425:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3426:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3427:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3428:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3499:Tmem181a UTSW 17 6280619 nonsense probably null
R3683:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R3893:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4226:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4227:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4428:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4430:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4465:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4466:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4467:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4496:Tmem181a UTSW 17 6295786 missense probably damaging 0.99
R4728:Tmem181a UTSW 17 6290599 missense probably benign 0.03
R4822:Tmem181a UTSW 17 6280665 missense probably benign 0.00
R5301:Tmem181a UTSW 17 6295795 missense possibly damaging 0.52
R5991:Tmem181a UTSW 17 6289037 missense probably damaging 1.00
R6052:Tmem181a UTSW 17 6280615 missense probably damaging 1.00
R6222:Tmem181a UTSW 17 6300917 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ACCATGGGAGAACTGTTTCTGG -3'
(R):5'- TGGTCAGCAATGACTCTCAC -3'

Sequencing Primer
(F):5'- CCATGGGAGAACTGTTTCTGGTAGTC -3'
(R):5'- TGGTCAGCAATGACTCTCACACTAC -3'
Posted On2015-07-07