Incidental Mutation 'R4347:Chil4'
ID328361
Institutional Source Beutler Lab
Gene Symbol Chil4
Ensembl Gene ENSMUSG00000063779
Gene Namechitinase-like 4
SynonymsYm2, Chi3l4
MMRRC Submission 041102-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.606) question?
Stock #R4347 (G1)
Quality Score203
Status Validated
Chromosome3
Chromosomal Location106201490-106219507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106202828 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 317 (I317V)
Ref Sequence ENSEMBL: ENSMUSP00000080851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082219]
Predicted Effect probably benign
Transcript: ENSMUST00000082219
AA Change: I317V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080851
Gene: ENSMUSG00000063779
AA Change: I317V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 1.77e-132 SMART
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik C T 11: 3,890,122 V92M probably damaging Het
4930503E14Rik C A 14: 44,171,178 R66S probably damaging Het
Abca5 A T 11: 110,299,968 I772N probably damaging Het
Acox1 T C 11: 116,198,661 N15S probably benign Het
Arhgap28 C T 17: 67,873,142 V233I probably benign Het
Dvl3 G A 16: 20,531,299 R645H possibly damaging Het
Efl1 A T 7: 82,697,966 M567L probably damaging Het
Gal3st2b C T 1: 93,939,808 T59I probably damaging Het
Gm7135 T A 1: 97,348,310 noncoding transcript Het
Gpihbp1 T G 15: 75,598,168 *124G probably null Het
Igkv10-96 T A 6: 68,632,180 R44W probably benign Het
Igkv13-84 T A 6: 68,939,776 I19K probably benign Het
Kcnab1 A G 3: 65,297,475 probably benign Het
Kif1b C A 4: 149,247,234 G545C probably damaging Het
Mprip T C 11: 59,759,453 S1328P possibly damaging Het
Nrp1 T C 8: 128,480,991 probably null Het
Olfml1 C T 7: 107,567,833 P23L probably benign Het
Plekhh2 G A 17: 84,619,702 A1457T probably benign Het
Prr27 A G 5: 87,842,672 I40V possibly damaging Het
Slc25a54 A G 3: 109,102,739 T185A possibly damaging Het
Srek1 C T 13: 103,748,759 G396D probably null Het
Syvn1 C T 19: 6,049,921 probably benign Het
Trim3 C T 7: 105,619,387 G120D probably damaging Het
Usp5 T A 6: 124,821,195 Q409L probably damaging Het
Vim T G 2: 13,575,518 probably benign Het
Other mutations in Chil4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Chil4 APN 3 106201797 missense probably benign
IGL02457:Chil4 APN 3 106214399 missense probably benign
R1087:Chil4 UTSW 3 106210565 missense probably benign 0.01
R1398:Chil4 UTSW 3 106219509 unclassified probably null
R1503:Chil4 UTSW 3 106206034 missense probably benign
R1553:Chil4 UTSW 3 106203690 missense probably benign 0.02
R1806:Chil4 UTSW 3 106210643 splice site probably benign
R1873:Chil4 UTSW 3 106206098 missense probably benign 0.00
R2069:Chil4 UTSW 3 106219455 missense probably benign 0.16
R2100:Chil4 UTSW 3 106214347 missense probably benign
R2370:Chil4 UTSW 3 106214300 nonsense probably null
R2984:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R2985:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R3522:Chil4 UTSW 3 106203740 missense probably benign 0.08
R3919:Chil4 UTSW 3 106202532 missense probably benign 0.00
R4033:Chil4 UTSW 3 106214449 missense probably damaging 1.00
R4181:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4184:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4301:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4391:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4395:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4418:Chil4 UTSW 3 106203727 missense possibly damaging 0.95
R4483:Chil4 UTSW 3 106214362 missense probably damaging 1.00
R4544:Chil4 UTSW 3 106210606 missense probably damaging 0.97
R4887:Chil4 UTSW 3 106204144 missense probably benign 0.01
R4949:Chil4 UTSW 3 106206092 missense possibly damaging 0.83
R5076:Chil4 UTSW 3 106202597 missense probably damaging 1.00
R5146:Chil4 UTSW 3 106202834 missense probably benign 0.18
R5254:Chil4 UTSW 3 106219452 missense probably benign 0.00
R5521:Chil4 UTSW 3 106203697 missense possibly damaging 0.50
R5790:Chil4 UTSW 3 106202578 missense probably benign 0.00
R5883:Chil4 UTSW 3 106210570 missense possibly damaging 0.48
R6010:Chil4 UTSW 3 106214395 missense probably damaging 1.00
R6257:Chil4 UTSW 3 106204096 missense possibly damaging 0.84
R6269:Chil4 UTSW 3 106204171 missense probably damaging 1.00
R6602:Chil4 UTSW 3 106210590 missense probably benign 0.00
X0067:Chil4 UTSW 3 106206034 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGTTGTCCTTGAGCCACTGAG -3'
(R):5'- TAGTTGTGCCCTGTAGAACCAG -3'

Sequencing Primer
(F):5'- GAGCCACTGAGCCTGTTGAAAC -3'
(R):5'- CTGTAGAACCAGGATTCAGGG -3'
Posted On2015-07-07