Incidental Mutation 'R4347:Acox1'
ID328376
Institutional Source Beutler Lab
Gene Symbol Acox1
Ensembl Gene ENSMUSG00000020777
Gene Nameacyl-Coenzyme A oxidase 1, palmitoyl
SynonymsAOX, Acyl-CoA oxidase, D130055E20Rik
MMRRC Submission 041102-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R4347 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location116171888-116199045 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116198661 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 15 (N15S)
Ref Sequence ENSEMBL: ENSMUSP00000072717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021130] [ENSMUST00000066587] [ENSMUST00000072948]
Predicted Effect probably benign
Transcript: ENSMUST00000021130
SMART Domains Protein: ENSMUSP00000021130
Gene: ENSMUSG00000020778

DomainStartEndE-ValueType
Pfam:Ten1_2 2 118 1.6e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066587
AA Change: N15S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000063325
Gene: ENSMUSG00000020777
AA Change: N15S

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 15 133 4.4e-39 PFAM
Pfam:Acyl-CoA_dh_M 135 245 3e-13 PFAM
SCOP:d1is2a1 272 460 1e-43 SMART
Pfam:ACOX 479 659 6.4e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072948
AA Change: N15S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000072717
Gene: ENSMUSG00000020777
AA Change: N15S

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 15 133 6.8e-38 PFAM
Pfam:Acyl-CoA_dh_M 135 195 1.3e-8 PFAM
SCOP:d1is2a1 272 460 9e-44 SMART
Pfam:ACOX 476 661 4.4e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146066
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: This gene encodes a member of the acyl-coenzyme A oxidase family. The encoded protein is localized to peroxisomes and is the first enzyme of the fatty acid beta-oxidation pathway, which catalyzes the desaturation of acyl-coenzyme A to 2-trans-enoyl-coenzyme A. Disruption of this gene results in microvesicular steatohepatitis, spontaneous peroxisome proliferation, and the eventual development of hepatocellular carcinomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a targeted mutation that inactivates the gene show growth retardation, infertility, excess very long chain fatty acids in the blood, and progressive liver disease, including hepatomegaly, and hepatic adenomas and carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik C T 11: 3,890,122 V92M probably damaging Het
4930503E14Rik C A 14: 44,171,178 R66S probably damaging Het
Abca5 A T 11: 110,299,968 I772N probably damaging Het
Arhgap28 C T 17: 67,873,142 V233I probably benign Het
Chil4 T C 3: 106,202,828 I317V probably benign Het
Dvl3 G A 16: 20,531,299 R645H possibly damaging Het
Efl1 A T 7: 82,697,966 M567L probably damaging Het
Gal3st2b C T 1: 93,939,808 T59I probably damaging Het
Gm7135 T A 1: 97,348,310 noncoding transcript Het
Gpihbp1 T G 15: 75,598,168 *124G probably null Het
Igkv10-96 T A 6: 68,632,180 R44W probably benign Het
Igkv13-84 T A 6: 68,939,776 I19K probably benign Het
Kcnab1 A G 3: 65,297,475 probably benign Het
Kif1b C A 4: 149,247,234 G545C probably damaging Het
Mprip T C 11: 59,759,453 S1328P possibly damaging Het
Nrp1 T C 8: 128,480,991 probably null Het
Olfml1 C T 7: 107,567,833 P23L probably benign Het
Plekhh2 G A 17: 84,619,702 A1457T probably benign Het
Prr27 A G 5: 87,842,672 I40V possibly damaging Het
Slc25a54 A G 3: 109,102,739 T185A possibly damaging Het
Srek1 C T 13: 103,748,759 G396D probably null Het
Syvn1 C T 19: 6,049,921 probably benign Het
Trim3 C T 7: 105,619,387 G120D probably damaging Het
Usp5 T A 6: 124,821,195 Q409L probably damaging Het
Vim T G 2: 13,575,518 probably benign Het
Other mutations in Acox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Acox1 APN 11 116174505 splice site probably benign
IGL02096:Acox1 APN 11 116178198 missense probably damaging 0.99
IGL03128:Acox1 APN 11 116182003 missense probably damaging 1.00
R0535:Acox1 UTSW 11 116174438 missense possibly damaging 0.73
R1718:Acox1 UTSW 11 116174682 nonsense probably null
R1728:Acox1 UTSW 11 116198283 unclassified probably null
R1971:Acox1 UTSW 11 116198261 missense probably benign 0.05
R3770:Acox1 UTSW 11 116174387 missense probably damaging 1.00
R4836:Acox1 UTSW 11 116175326 missense probably benign 0.05
R5551:Acox1 UTSW 11 116189491 missense possibly damaging 0.73
R6662:Acox1 UTSW 11 116175323 missense probably damaging 1.00
R6685:Acox1 UTSW 11 116180348 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGAACAGAGGACGTTCCCC -3'
(R):5'- ACCTTGCTTTCCTTGGCGAG -3'

Sequencing Primer
(F):5'- GAGGACGTTCCCCTCCTAATC -3'
(R):5'- TACCAGCGTCGGGGATTG -3'
Posted On2015-07-07