Incidental Mutation 'R4347:Arhgap28'
ID328381
Institutional Source Beutler Lab
Gene Symbol Arhgap28
Ensembl Gene ENSMUSG00000024043
Gene NameRho GTPase activating protein 28
Synonyms
MMRRC Submission 041102-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R4347 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location67842713-68004120 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67873142 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 233 (V233I)
Ref Sequence ENSEMBL: ENSMUSP00000128194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024840] [ENSMUST00000163865] [ENSMUST00000164647]
Predicted Effect probably benign
Transcript: ENSMUST00000024840
AA Change: V283I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024840
Gene: ENSMUSG00000024043
AA Change: V283I

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
RhoGAP 400 578 1.41e-34 SMART
Blast:RhoGAP 583 612 2e-7 BLAST
Blast:RhoGAP 640 681 9e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163865
AA Change: V233I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130960
Gene: ENSMUSG00000024043
AA Change: V233I

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
RhoGAP 350 527 7.1e-31 SMART
Blast:RhoGAP 532 561 1e-7 BLAST
Blast:RhoGAP 589 630 8e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164647
AA Change: V233I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128194
Gene: ENSMUSG00000024043
AA Change: V233I

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
RhoGAP 350 528 1.41e-34 SMART
Blast:RhoGAP 533 562 1e-7 BLAST
Blast:RhoGAP 590 631 8e-6 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000170581
AA Change: V87I
SMART Domains Protein: ENSMUSP00000131903
Gene: ENSMUSG00000024043
AA Change: V87I

DomainStartEndE-ValueType
Blast:RhoGAP 151 213 1e-33 BLAST
SCOP:d1tx4a_ 182 235 1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170813
SMART Domains Protein: ENSMUSP00000132087
Gene: ENSMUSG00000024043

DomainStartEndE-ValueType
RhoGAP 87 208 7.57e-4 SMART
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal bone length and ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik C T 11: 3,890,122 V92M probably damaging Het
4930503E14Rik C A 14: 44,171,178 R66S probably damaging Het
Abca5 A T 11: 110,299,968 I772N probably damaging Het
Acox1 T C 11: 116,198,661 N15S probably benign Het
Chil4 T C 3: 106,202,828 I317V probably benign Het
Dvl3 G A 16: 20,531,299 R645H possibly damaging Het
Efl1 A T 7: 82,697,966 M567L probably damaging Het
Gal3st2b C T 1: 93,939,808 T59I probably damaging Het
Gm7135 T A 1: 97,348,310 noncoding transcript Het
Gpihbp1 T G 15: 75,598,168 *124G probably null Het
Igkv10-96 T A 6: 68,632,180 R44W probably benign Het
Igkv13-84 T A 6: 68,939,776 I19K probably benign Het
Kcnab1 A G 3: 65,297,475 probably benign Het
Kif1b C A 4: 149,247,234 G545C probably damaging Het
Mprip T C 11: 59,759,453 S1328P possibly damaging Het
Nrp1 T C 8: 128,480,991 probably null Het
Olfml1 C T 7: 107,567,833 P23L probably benign Het
Plekhh2 G A 17: 84,619,702 A1457T probably benign Het
Prr27 A G 5: 87,842,672 I40V possibly damaging Het
Slc25a54 A G 3: 109,102,739 T185A possibly damaging Het
Srek1 C T 13: 103,748,759 G396D probably null Het
Syvn1 C T 19: 6,049,921 probably benign Het
Trim3 C T 7: 105,619,387 G120D probably damaging Het
Usp5 T A 6: 124,821,195 Q409L probably damaging Het
Vim T G 2: 13,575,518 probably benign Het
Other mutations in Arhgap28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Arhgap28 APN 17 67845801 missense probably damaging 1.00
IGL01388:Arhgap28 APN 17 67853039 unclassified probably benign
IGL01560:Arhgap28 APN 17 67896071 missense probably damaging 1.00
IGL01578:Arhgap28 APN 17 67858200 missense probably benign 0.00
IGL01650:Arhgap28 APN 17 67873132 missense probably damaging 0.97
IGL02383:Arhgap28 APN 17 67896089 missense probably benign 0.00
IGL02403:Arhgap28 APN 17 67873159 missense possibly damaging 0.87
IGL02652:Arhgap28 APN 17 67884800 missense probably benign 0.00
IGL03102:Arhgap28 APN 17 67896236 missense probably damaging 1.00
IGL03209:Arhgap28 APN 17 67868956 missense probably damaging 1.00
IGL03306:Arhgap28 APN 17 67852935 missense probably damaging 1.00
K3955:Arhgap28 UTSW 17 68004006 missense probably damaging 0.98
R0135:Arhgap28 UTSW 17 67864588 missense probably damaging 1.00
R0309:Arhgap28 UTSW 17 67901429 missense probably benign 0.13
R0385:Arhgap28 UTSW 17 67864606 missense probably damaging 1.00
R0412:Arhgap28 UTSW 17 67896258 missense probably damaging 1.00
R0463:Arhgap28 UTSW 17 67896225 missense probably damaging 1.00
R0626:Arhgap28 UTSW 17 67896113 unclassified probably null
R0691:Arhgap28 UTSW 17 67896164 unclassified probably null
R0811:Arhgap28 UTSW 17 67901299 small deletion probably benign
R1150:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1151:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1152:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1426:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1427:Arhgap28 UTSW 17 67857464 missense probably damaging 1.00
R1632:Arhgap28 UTSW 17 67849074 missense probably damaging 0.99
R1747:Arhgap28 UTSW 17 67901309 missense probably benign 0.02
R1951:Arhgap28 UTSW 17 67901341 missense probably benign 0.00
R2031:Arhgap28 UTSW 17 67896116 missense probably damaging 1.00
R2126:Arhgap28 UTSW 17 67869015 missense possibly damaging 0.90
R2181:Arhgap28 UTSW 17 67896117 missense probably damaging 1.00
R3700:Arhgap28 UTSW 17 67901366 missense probably damaging 1.00
R3800:Arhgap28 UTSW 17 67873036 missense probably damaging 1.00
R3811:Arhgap28 UTSW 17 67896093 missense probably benign
R4213:Arhgap28 UTSW 17 67871993 missense probably benign 0.04
R4954:Arhgap28 UTSW 17 67869013 nonsense probably null
R5592:Arhgap28 UTSW 17 67858272 missense probably damaging 0.99
R5610:Arhgap28 UTSW 17 67896240 nonsense probably null
R5758:Arhgap28 UTSW 17 67873159 missense probably benign 0.04
R5774:Arhgap28 UTSW 17 67881492 missense possibly damaging 0.94
R6413:Arhgap28 UTSW 17 67875588 missense probably benign 0.00
R6661:Arhgap28 UTSW 17 67845751 missense probably damaging 1.00
R6928:Arhgap28 UTSW 17 67901299 small deletion probably benign
Z1088:Arhgap28 UTSW 17 67861277 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ATATCCCAGGAGACACACGG -3'
(R):5'- GTCAAGGCAATACCAGGTCAC -3'

Sequencing Primer
(F):5'- CAGGAGACACACGGTGCTG -3'
(R):5'- AGGTCACCCAGTCAGCTAG -3'
Posted On2015-07-07