Incidental Mutation 'R0038:Cldn8'
ID32845
Institutional Source Beutler Lab
Gene Symbol Cldn8
Ensembl Gene ENSMUSG00000050520
Gene Nameclaudin 8
Synonyms
MMRRC Submission 038332-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R0038 (G1)
Quality Score185
Status Validated (trace)
Chromosome16
Chromosomal Location88560828-88563183 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 88563034 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000051887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049697]
Predicted Effect probably null
Transcript: ENSMUST00000049697
AA Change: M1T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051887
Gene: ENSMUSG00000050520
AA Change: M1T

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 2.9e-32 PFAM
Pfam:Claudin_2 15 184 5.6e-10 PFAM
Meta Mutation Damage Score 0.302 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: This intronless gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is a paracellular cation barrier. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,886,102 probably benign Het
Ankrd28 A T 14: 31,708,035 M892K probably damaging Het
Arhgef25 T C 10: 127,186,865 probably benign Het
Arl9 G A 5: 77,006,475 E17K probably benign Het
Bbs9 G A 9: 22,504,094 V105I probably benign Het
Celsr1 A T 15: 85,929,419 N1997K possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clec11a A G 7: 44,306,482 probably benign Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Col19a1 A T 1: 24,559,744 L56Q unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2b10 G A 7: 25,914,862 A254T probably benign Het
Ddx39 T C 8: 83,722,498 L305P probably damaging Het
Depdc5 A G 5: 32,868,853 E60G probably benign Het
Eif2ak2 T A 17: 78,863,955 M340L probably benign Het
Etl4 A T 2: 20,743,574 H39L probably damaging Het
Fat3 T C 9: 15,915,010 T4549A probably damaging Het
Fbxw28 A T 9: 109,338,540 W50R probably damaging Het
Ggt7 T C 2: 155,502,781 D214G probably benign Het
Gramd1b G A 9: 40,317,526 T252M probably damaging Het
Grin1 T C 2: 25,297,459 N613S probably null Het
Hcrtr2 A T 9: 76,259,681 S125T probably benign Het
Hr T C 14: 70,568,085 L1091P probably damaging Het
Htr2a T G 14: 74,706,247 S422R probably benign Het
Ighmbp2 A G 19: 3,262,097 S886P probably damaging Het
Iqcg C A 16: 33,045,642 L110F probably benign Het
Kirrel3 T A 9: 34,911,770 probably null Het
Kremen1 A C 11: 5,207,703 probably benign Het
Lama2 T C 10: 26,986,797 D2990G probably benign Het
Lin52 C G 12: 84,529,725 L111V probably damaging Het
Myh15 T C 16: 49,071,141 probably benign Het
Ncor1 A G 11: 62,392,551 F437L probably damaging Het
Nlrp1b A G 11: 71,172,171 S685P possibly damaging Het
Oog4 T C 4: 143,438,944 D211G probably benign Het
Oscar A G 7: 3,616,073 V2A probably benign Het
Pdzd8 A G 19: 59,299,596 I1124T possibly damaging Het
Pgm3 A T 9: 86,564,673 probably benign Het
Pnpla5 A G 15: 84,122,513 Y90H probably damaging Het
Polr1b C T 2: 129,115,668 R548* probably null Het
Ptprg T A 14: 12,213,710 M1026K probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rapgef2 T C 3: 79,069,396 I1368V probably benign Het
Rnf168 T C 16: 32,298,995 V458A probably benign Het
Rnf32 T C 5: 29,205,654 probably benign Het
Sclt1 T C 3: 41,629,508 probably benign Het
Serpina12 A G 12: 104,037,957 F139L probably damaging Het
Sos2 T G 12: 69,596,693 Q971P probably damaging Het
Stag3 T A 5: 138,301,036 probably null Het
Stard5 T C 7: 83,636,743 probably benign Het
Stard9 T A 2: 120,695,832 C857S probably benign Het
Suclg1 A G 6: 73,260,503 E77G probably benign Het
Trpm7 A G 2: 126,795,468 S204P probably damaging Het
Ush2a G T 1: 188,626,612 G2112C probably benign Het
Vmn2r15 T A 5: 109,293,144 T283S possibly damaging Het
Wdr6 A T 9: 108,572,969 V1120D probably damaging Het
Zfp644 T G 5: 106,635,043 E1155A probably benign Het
Other mutations in Cldn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02888:Cldn8 APN 16 88562383 missense probably benign 0.00
R0038:Cldn8 UTSW 16 88563034 start codon destroyed probably null 1.00
R0332:Cldn8 UTSW 16 88562358 synonymous silent
R0690:Cldn8 UTSW 16 88562639 missense probably damaging 1.00
R1496:Cldn8 UTSW 16 88562401 missense probably benign
R1832:Cldn8 UTSW 16 88562858 missense probably benign 0.07
R3052:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R3053:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4428:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4429:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4430:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4431:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4465:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4485:Cldn8 UTSW 16 88562731 missense probably damaging 1.00
R4659:Cldn8 UTSW 16 88562408 missense probably benign
R4660:Cldn8 UTSW 16 88562408 missense probably benign
R4662:Cldn8 UTSW 16 88562408 missense probably benign
R4679:Cldn8 UTSW 16 88562408 missense probably benign
R4741:Cldn8 UTSW 16 88562408 missense probably benign
R6591:Cldn8 UTSW 16 88562535 missense possibly damaging 0.73
R6691:Cldn8 UTSW 16 88562535 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GCTGTCATGAAAGCCAAGAAAGCC -3'
(R):5'- AGTTTACTGTTGGAGCCAAAGGGG -3'

Sequencing Primer
(F):5'- AGTCGTAGACCTTGCACTG -3'
(R):5'- AAGAGGGGGTTGTGTCACC -3'
Posted On2013-05-09