Incidental Mutation 'R4350:Rchy1'
ID 328468
Institutional Source Beutler Lab
Gene Symbol Rchy1
Ensembl Gene ENSMUSG00000029397
Gene Name ring finger and CHY zinc finger domain containing 1
Synonyms 6720407C15Rik, PRO1996, Pirh2, Zfp363
MMRRC Submission 041105-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.590) question?
Stock # R4350 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 92096763-92110927 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92105813 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 45 (D45G)
Ref Sequence ENSEMBL: ENSMUSP00000031345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031345] [ENSMUST00000169948]
AlphaFold Q9CR50
PDB Structure Solution structure of the CHY zinc finger domain of the RING finger and CHY zinc finger domain-containing protein 1 from Mus musculus [SOLUTION NMR]
Solution structure of the RING domain of the RING finger and CHY zinc finger domain-containing protein 1 from Mus musculus [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000031345
AA Change: D45G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031345
Gene: ENSMUSG00000029397
AA Change: D45G

DomainStartEndE-ValueType
Pfam:zf-CHY 20 93 2.2e-24 PFAM
low complexity region 119 130 N/A INTRINSIC
RING 145 186 1.38e-7 SMART
Pfam:zinc_ribbon_6 191 249 6.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140670
Predicted Effect probably benign
Transcript: ENSMUST00000169948
SMART Domains Protein: ENSMUSP00000131270
Gene: ENSMUSG00000029397

DomainStartEndE-ValueType
PDB:2DKT|A 10 99 2e-41 PDB
RING 105 146 1.38e-7 SMART
Pfam:zinc_ribbon_6 150 210 3.1e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200905
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein containing CHY-, CTCHY-, and RING-type zinc-fingers. The encoded protein functions as an E3 ubiquitin ligase, and mediates the degradation of target proteins such as p53. The activity of this protein is important in cell cycle regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mouse embryonic fibroblasts from mice homozygous for a knock-out allele exhibit decreased cellular sensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,498,020 (GRCm39) probably null Het
Adamts1 T A 16: 85,599,234 (GRCm39) D122V probably benign Het
Ap3d1 T C 10: 80,555,119 (GRCm39) D402G probably benign Het
Ccdc88b T C 19: 6,827,640 (GRCm39) E954G probably damaging Het
Cdh20 A G 1: 104,906,814 (GRCm39) D547G probably damaging Het
Cst13 A G 2: 148,672,169 (GRCm39) M115V probably benign Het
Ctr9 T A 7: 110,648,525 (GRCm39) Y722N probably damaging Het
Dvl3 T C 16: 20,344,394 (GRCm39) Y257H possibly damaging Het
Dzip1 T C 14: 119,120,938 (GRCm39) D673G probably benign Het
Enah A T 1: 181,749,985 (GRCm39) S266T possibly damaging Het
Epha7 T C 4: 28,950,393 (GRCm39) V732A probably damaging Het
F13b A G 1: 139,444,036 (GRCm39) I457V probably benign Het
Fam98a A G 17: 75,848,220 (GRCm39) F165L probably damaging Het
Gcn1 G T 5: 115,741,389 (GRCm39) R1476L probably damaging Het
Gfy T C 7: 44,827,040 (GRCm39) E352G probably benign Het
Inava C T 1: 136,153,946 (GRCm39) V180I probably damaging Het
Lyn G A 4: 3,789,796 (GRCm39) R443H probably damaging Het
Mecom C A 3: 30,020,887 (GRCm39) V452L possibly damaging Het
Msh6 A G 17: 88,292,012 (GRCm39) S256G probably damaging Het
Ncor1 A G 11: 62,301,644 (GRCm39) probably null Het
Pabpc4 C T 4: 123,184,060 (GRCm39) T191I probably damaging Het
Ptch1 C T 13: 63,682,143 (GRCm39) R537H probably damaging Het
Rftn2 T C 1: 55,233,440 (GRCm39) T372A probably damaging Het
Rlf G A 4: 121,006,293 (GRCm39) P896S probably benign Het
Rnf31 AAC A 14: 55,838,555 (GRCm39) probably null Het
Rpl7a-ps3 T C 15: 36,308,283 (GRCm39) noncoding transcript Het
Sox7 A G 14: 64,185,995 (GRCm39) T344A probably benign Het
Sppl2b T C 10: 80,698,560 (GRCm39) Y127H probably benign Het
Srsf12 T C 4: 33,223,612 (GRCm39) V37A possibly damaging Het
Sst A G 16: 23,708,565 (GRCm39) S89P probably damaging Het
Svil T A 18: 5,118,154 (GRCm39) C1705S probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Tubgcp3 T C 8: 12,691,117 (GRCm39) T474A probably benign Het
Tubgcp6 G A 15: 88,988,198 (GRCm39) P925L probably benign Het
Other mutations in Rchy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02471:Rchy1 APN 5 92,105,405 (GRCm39) nonsense probably null
IGL02668:Rchy1 APN 5 92,110,577 (GRCm39) start codon destroyed probably null 0.43
IGL03251:Rchy1 APN 5 92,110,502 (GRCm39) missense probably benign 0.08
R0137:Rchy1 UTSW 5 92,105,458 (GRCm39) missense probably benign 0.01
R0959:Rchy1 UTSW 5 92,105,476 (GRCm39) missense probably damaging 0.99
R1462:Rchy1 UTSW 5 92,105,741 (GRCm39) missense probably damaging 1.00
R1462:Rchy1 UTSW 5 92,105,741 (GRCm39) missense probably damaging 1.00
R1531:Rchy1 UTSW 5 92,103,474 (GRCm39) critical splice acceptor site probably null
R1868:Rchy1 UTSW 5 92,099,762 (GRCm39) missense probably damaging 0.99
R4953:Rchy1 UTSW 5 92,110,487 (GRCm39) critical splice donor site probably null
R6223:Rchy1 UTSW 5 92,105,826 (GRCm39) missense probably damaging 1.00
R6345:Rchy1 UTSW 5 92,105,801 (GRCm39) missense probably benign 0.08
R6546:Rchy1 UTSW 5 92,105,817 (GRCm39) missense probably damaging 1.00
R8311:Rchy1 UTSW 5 92,099,762 (GRCm39) missense probably damaging 0.99
R8711:Rchy1 UTSW 5 92,105,397 (GRCm39) missense probably damaging 1.00
R9225:Rchy1 UTSW 5 92,105,396 (GRCm39) nonsense probably null
R9267:Rchy1 UTSW 5 92,105,831 (GRCm39) missense probably benign 0.04
R9269:Rchy1 UTSW 5 92,105,831 (GRCm39) missense probably benign 0.04
R9291:Rchy1 UTSW 5 92,099,765 (GRCm39) missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CCTCCTCAGAGAATTAAGTCTCATTTC -3'
(R):5'- TCTTCTGTTAGGCTGAGAACGAG -3'

Sequencing Primer
(F):5'- CCATACGGCCTTACATGT -3'
(R):5'- GAACGAGAGTTGAGTGTTAT -3'
Posted On 2015-07-07