Incidental Mutation 'R4350:Ctr9'
ID328471
Institutional Source Beutler Lab
Gene Symbol Ctr9
Ensembl Gene ENSMUSG00000005609
Gene NameCTR9 homolog, Paf1/RNA polymerase II complex component
SynonymsTsbp, Tsp, Sh2bp1
MMRRC Submission 041105-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.974) question?
Stock #R4350 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location111028951-111056377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111049318 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 722 (Y722N)
Ref Sequence ENSEMBL: ENSMUSP00000005749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005749]
Predicted Effect probably damaging
Transcript: ENSMUST00000005749
AA Change: Y722N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000005749
Gene: ENSMUSG00000005609
AA Change: Y722N

DomainStartEndE-ValueType
TPR 163 196 2.26e-3 SMART
TPR 198 231 2e-4 SMART
low complexity region 232 241 N/A INTRINSIC
TPR 306 339 4.52e-3 SMART
TPR 341 374 1.39e-3 SMART
TPR 451 484 3.56e-1 SMART
TPR 497 530 7.34e-3 SMART
TPR 531 564 3.24e-4 SMART
Blast:TPR 565 598 2e-14 BLAST
TPR 681 714 9.03e-3 SMART
TPR 717 750 1.6e1 SMART
coiled coil region 828 889 N/A INTRINSIC
low complexity region 892 916 N/A INTRINSIC
low complexity region 923 928 N/A INTRINSIC
low complexity region 932 1002 N/A INTRINSIC
low complexity region 1005 1028 N/A INTRINSIC
low complexity region 1034 1050 N/A INTRINSIC
low complexity region 1072 1090 N/A INTRINSIC
low complexity region 1133 1159 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209912
Meta Mutation Damage Score 0.368 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the PAF1 complex, which associates with RNA polymerase II and functions in transcriptional regulation and elongation. This complex also plays a role in the modification of histones. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
Abca17 A G 17: 24,279,046 probably null Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Ap3d1 T C 10: 80,719,285 D402G probably benign Het
Ccdc88b T C 19: 6,850,272 E954G probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Cst13 A G 2: 148,830,249 M115V probably benign Het
Dvl3 T C 16: 20,525,644 Y257H possibly damaging Het
Dzip1 T C 14: 118,883,526 D673G probably benign Het
Enah A T 1: 181,922,420 S266T possibly damaging Het
Epha7 T C 4: 28,950,393 V732A probably damaging Het
F13b A G 1: 139,516,298 I457V probably benign Het
Fam98a A G 17: 75,541,225 F165L probably damaging Het
Gcn1l1 G T 5: 115,603,330 R1476L probably damaging Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Lyn G A 4: 3,789,796 R443H probably damaging Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Msh6 A G 17: 87,984,584 S256G probably damaging Het
Ncor1 A G 11: 62,410,818 probably null Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rchy1 T C 5: 91,957,954 D45G probably damaging Het
Rftn2 T C 1: 55,194,281 T372A probably damaging Het
Rlf G A 4: 121,149,096 P896S probably benign Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rpl7a-ps3 T C 15: 36,308,137 noncoding transcript Het
Sox7 A G 14: 63,948,546 T344A probably benign Het
Sppl2b T C 10: 80,862,726 Y127H probably benign Het
Srsf12 T C 4: 33,223,612 V37A possibly damaging Het
Sst A G 16: 23,889,815 S89P probably damaging Het
Svil T A 18: 5,118,154 C1705S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp3 T C 8: 12,641,117 T474A probably benign Het
Tubgcp6 G A 15: 89,103,995 P925L probably benign Het
Other mutations in Ctr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Ctr9 APN 7 111049331 missense probably damaging 1.00
IGL02379:Ctr9 APN 7 111051519 missense probably damaging 0.99
IGL02451:Ctr9 APN 7 111043424 nonsense probably null
IGL03222:Ctr9 APN 7 111043050 missense probably benign 0.41
R0023:Ctr9 UTSW 7 111043947 missense possibly damaging 0.83
R0023:Ctr9 UTSW 7 111043947 missense possibly damaging 0.83
R0586:Ctr9 UTSW 7 111049498 splice site probably benign
R0761:Ctr9 UTSW 7 111046272 missense probably damaging 0.97
R0834:Ctr9 UTSW 7 111050952 missense probably benign 0.06
R1593:Ctr9 UTSW 7 111042853 missense possibly damaging 0.82
R1711:Ctr9 UTSW 7 111055663 missense unknown
R1828:Ctr9 UTSW 7 111043958 synonymous probably null
R1838:Ctr9 UTSW 7 111052303 missense possibly damaging 0.93
R2037:Ctr9 UTSW 7 111046807 missense probably benign 0.04
R2171:Ctr9 UTSW 7 111046910 missense possibly damaging 0.69
R2512:Ctr9 UTSW 7 111046871 missense probably damaging 1.00
R2850:Ctr9 UTSW 7 111053446 missense unknown
R2851:Ctr9 UTSW 7 111053446 missense unknown
R3124:Ctr9 UTSW 7 111053446 missense unknown
R4049:Ctr9 UTSW 7 111055543 missense unknown
R4280:Ctr9 UTSW 7 111046723 intron probably benign
R4352:Ctr9 UTSW 7 111049318 missense probably damaging 1.00
R4460:Ctr9 UTSW 7 111046894 missense probably benign 0.01
R4740:Ctr9 UTSW 7 111035371 missense probably benign 0.31
R5039:Ctr9 UTSW 7 111042857 missense probably benign 0.28
R5216:Ctr9 UTSW 7 111045458 missense possibly damaging 0.68
R5647:Ctr9 UTSW 7 111055544 missense unknown
R5677:Ctr9 UTSW 7 111044002 missense probably benign 0.45
R6907:Ctr9 UTSW 7 111030242 missense probably damaging 1.00
Z1088:Ctr9 UTSW 7 111030224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATGAGAATACCTCCCTGC -3'
(R):5'- GGTAGCTTCTTATGACTGAATGCC -3'

Sequencing Primer
(F):5'- TCCTGGAACTTGACCTGTAGAGC -3'
(R):5'- TCTTATGACTGAATGCCACCAAAAG -3'
Posted On2015-07-07