Incidental Mutation 'R4350:Abca17'
ID328486
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene NameATP-binding cassette, sub-family A (ABC1), member 17
Synonyms
MMRRC Submission 041105-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R4350 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24264259-24351029 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 24279046 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
Predicted Effect probably null
Transcript: ENSMUST00000039324
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121226
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik C T 1: 136,226,208 V180I probably damaging Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Ap3d1 T C 10: 80,719,285 D402G probably benign Het
Ccdc88b T C 19: 6,850,272 E954G probably damaging Het
Cdh20 A G 1: 104,979,089 D547G probably damaging Het
Cst13 A G 2: 148,830,249 M115V probably benign Het
Ctr9 T A 7: 111,049,318 Y722N probably damaging Het
Dvl3 T C 16: 20,525,644 Y257H possibly damaging Het
Dzip1 T C 14: 118,883,526 D673G probably benign Het
Enah A T 1: 181,922,420 S266T possibly damaging Het
Epha7 T C 4: 28,950,393 V732A probably damaging Het
F13b A G 1: 139,516,298 I457V probably benign Het
Fam98a A G 17: 75,541,225 F165L probably damaging Het
Gcn1l1 G T 5: 115,603,330 R1476L probably damaging Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Lyn G A 4: 3,789,796 R443H probably damaging Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Msh6 A G 17: 87,984,584 S256G probably damaging Het
Ncor1 A G 11: 62,410,818 probably null Het
Pabpc4 C T 4: 123,290,267 T191I probably damaging Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rchy1 T C 5: 91,957,954 D45G probably damaging Het
Rftn2 T C 1: 55,194,281 T372A probably damaging Het
Rlf G A 4: 121,149,096 P896S probably benign Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Rpl7a-ps3 T C 15: 36,308,137 noncoding transcript Het
Sox7 A G 14: 63,948,546 T344A probably benign Het
Sppl2b T C 10: 80,862,726 Y127H probably benign Het
Srsf12 T C 4: 33,223,612 V37A possibly damaging Het
Sst A G 16: 23,889,815 S89P probably damaging Het
Svil T A 18: 5,118,154 C1705S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubgcp3 T C 8: 12,641,117 T474A probably benign Het
Tubgcp6 G A 15: 89,103,995 P925L probably benign Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24295191 missense probably benign 0.14
IGL00585:Abca17 APN 17 24300320 missense probably damaging 0.99
IGL00941:Abca17 APN 17 24317130 missense probably damaging 1.00
IGL01987:Abca17 APN 17 24346228 missense probably benign 0.00
IGL01988:Abca17 APN 17 24334255 missense probably damaging 0.99
IGL02223:Abca17 APN 17 24287935 nonsense probably null
IGL02368:Abca17 APN 17 24287793 missense probably benign 0.01
IGL02405:Abca17 APN 17 24279062 missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24298984 missense probably benign 0.05
IGL02607:Abca17 APN 17 24327705 nonsense probably null
IGL02706:Abca17 APN 17 24298992 missense probably benign 0.00
IGL02729:Abca17 APN 17 24280481 missense probably benign 0.06
IGL02818:Abca17 APN 17 24300352 missense probably benign 0.02
IGL02891:Abca17 APN 17 24281366 missense probably damaging 0.99
IGL03236:Abca17 APN 17 24326476 splice site probably benign
IGL03299:Abca17 APN 17 24265591 missense probably damaging 1.00
R0018:Abca17 UTSW 17 24313188 splice site probably null
R0467:Abca17 UTSW 17 24313177 splice site probably benign
R0671:Abca17 UTSW 17 24281249 missense probably benign 0.00
R1175:Abca17 UTSW 17 24289351 missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24285759 missense probably benign 0.18
R1398:Abca17 UTSW 17 24328537 missense probably damaging 0.96
R1678:Abca17 UTSW 17 24335620 missense probably benign 0.05
R1696:Abca17 UTSW 17 24267658 missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24267557 missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24267716 missense probably damaging 1.00
R1970:Abca17 UTSW 17 24307575 missense probably benign 0.00
R1997:Abca17 UTSW 17 24285726 missense probably benign 0.02
R2141:Abca17 UTSW 17 24334266 missense probably benign 0.00
R2199:Abca17 UTSW 17 24335624 missense probably benign 0.19
R2394:Abca17 UTSW 17 24281216 splice site probably null
R2442:Abca17 UTSW 17 24328632 missense probably benign 0.02
R2509:Abca17 UTSW 17 24289613 splice site probably benign
R2848:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2849:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2859:Abca17 UTSW 17 24281314 missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2935:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3153:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3154:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3434:Abca17 UTSW 17 24289537 missense probably damaging 1.00
R3695:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3905:Abca17 UTSW 17 24296283 missense probably benign 0.13
R4282:Abca17 UTSW 17 24299060 missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24318268 missense probably damaging 1.00
R4548:Abca17 UTSW 17 24334271 missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24321084 missense probably damaging 1.00
R4722:Abca17 UTSW 17 24265429 missense probably damaging 1.00
R4745:Abca17 UTSW 17 24307453 missense probably damaging 1.00
R4818:Abca17 UTSW 17 24317161 missense probably damaging 0.98
R5279:Abca17 UTSW 17 24289414 missense probably damaging 1.00
R5310:Abca17 UTSW 17 24281230 missense probably benign 0.00
R5320:Abca17 UTSW 17 24307567 missense probably damaging 1.00
R5435:Abca17 UTSW 17 24267614 missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24327668 missense probably benign 0.14
R5776:Abca17 UTSW 17 24295158 missense probably benign 0.09
R5928:Abca17 UTSW 17 24318185 missense probably benign 0.01
R6013:Abca17 UTSW 17 24287846 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24318191 missense probably benign 0.00
R6063:Abca17 UTSW 17 24264344 missense unknown
R6404:Abca17 UTSW 17 24265918 missense probably benign 0.13
R6746:Abca17 UTSW 17 24346221 nonsense probably null
R6819:Abca17 UTSW 17 24287793 missense probably benign 0.01
R6828:Abca17 UTSW 17 24326415 missense possibly damaging 0.91
X0017:Abca17 UTSW 17 24317163 missense probably benign 0.26
X0065:Abca17 UTSW 17 24334284 missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24279079 missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24279107 missense probably benign 0.03
Z1088:Abca17 UTSW 17 24346219 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACTACTATGGAGCTCACTGTG -3'
(R):5'- TACCCCTGTTGGCTGTGAAC -3'

Sequencing Primer
(F):5'- GCTCTTGTAAGCACTTGAGAGAC -3'
(R):5'- GGCTGTGAACAAGGTGTCC -3'
Posted On2015-07-07