Incidental Mutation 'R4351:Hsd17b4'
ID328529
Institutional Source Beutler Lab
Gene Symbol Hsd17b4
Ensembl Gene ENSMUSG00000024507
Gene Namehydroxysteroid (17-beta) dehydrogenase 4
SynonymsD-bifunctional protein, MFP2, multifunctional protein 2, 17[b]-HSD, Mfp-2, perMFE-2, MFE-2
MMRRC Submission 041106-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R4351 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location50128201-50196269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50142634 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 115 (D115V)
Ref Sequence ENSEMBL: ENSMUSP00000025385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025385]
Predicted Effect probably damaging
Transcript: ENSMUST00000025385
AA Change: D115V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025385
Gene: ENSMUSG00000024507
AA Change: D115V

DomainStartEndE-ValueType
Pfam:KR 10 186 2.1e-17 PFAM
Pfam:adh_short 10 208 2.3e-39 PFAM
Pfam:MaoC_dehydrat_N 346 451 1.4e-8 PFAM
low complexity region 458 470 N/A INTRINSIC
Pfam:MaoC_dehydratas 479 600 1.8e-41 PFAM
Pfam:SCP2 627 730 8.4e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152388
Meta Mutation Damage Score 0.338 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that is involved in the peroxisomal beta-oxidation pathway for fatty acids. It also acts as a catalyst for the formation of 3-ketoacyl-CoA intermediates from both straight-chain and 2-methyl-branched-chain fatty acids. Defects in this gene that affect the peroxisomal fatty acid beta-oxidation activity are a cause of D-bifunctional protein deficiency (DBPD). An apparent pseudogene of this gene is present on chromosome 8. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities in fatty acid metabolism, retarded growth, abnormal bile salt composition, impaired coordination, demyelination and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,624,912 F635S probably benign Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Aak1 A G 6: 86,935,537 probably null Het
Abtb2 T A 2: 103,683,393 D382E possibly damaging Het
Adamts1 T A 16: 85,802,346 D122V probably benign Het
Adcy6 A T 15: 98,604,160 V191E probably benign Het
Adh1 A G 3: 138,280,497 T82A probably benign Het
Ak6 C T 13: 100,655,603 Q185* probably null Het
Aldh6a1 A G 12: 84,443,761 Y27H probably benign Het
Apob A G 12: 7,993,054 M812V probably benign Het
Arhgef10 C A 8: 14,991,145 S748* probably null Het
Brd3 A T 2: 27,457,016 Y369N probably damaging Het
Dhh A G 15: 98,898,218 probably benign Het
Disp1 A G 1: 183,099,978 V200A probably benign Het
Dvl3 T C 16: 20,525,644 Y257H possibly damaging Het
Dzip1 T C 14: 118,883,526 D673G probably benign Het
Evx1 A G 6: 52,313,861 D6G probably damaging Het
Fam71f1 C G 6: 29,320,801 I141M probably damaging Het
Gfy T C 7: 45,177,616 E352G probably benign Het
Hars2 A G 18: 36,786,178 E123G probably damaging Het
Lyn G A 4: 3,789,796 R443H probably damaging Het
Mecom C A 3: 29,966,738 V452L possibly damaging Het
Nckap1l A G 15: 103,486,819 T909A probably damaging Het
Ncor1 A G 11: 62,410,818 probably null Het
Nrp2 A G 1: 62,738,417 D127G probably damaging Het
Olfr1396 A G 11: 49,113,703 S8P probably damaging Het
Olfr965 T A 9: 39,719,569 M114K probably damaging Het
Prpmp5 T G 6: 132,313,661 Y25S unknown Het
Ptch1 C T 13: 63,534,329 R537H probably damaging Het
Rabgap1 A G 2: 37,483,782 T269A probably benign Het
Rnf31 AAC A 14: 55,601,098 probably null Het
Sptbn5 T C 2: 120,083,199 noncoding transcript Het
Sst A G 16: 23,889,815 S89P probably damaging Het
Tm2d3 A G 7: 65,695,191 Y49C probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Wdr81 A G 11: 75,441,812 L1921P probably damaging Het
Other mutations in Hsd17b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Hsd17b4 APN 18 50164845 missense probably benign
IGL01369:Hsd17b4 APN 18 50172033 missense possibly damaging 0.95
IGL01411:Hsd17b4 APN 18 50191814 missense probably damaging 1.00
IGL01986:Hsd17b4 APN 18 50160126 splice site probably benign
IGL02126:Hsd17b4 APN 18 50181996 missense probably benign
IGL02496:Hsd17b4 APN 18 50155153 missense probably damaging 0.97
IGL02527:Hsd17b4 APN 18 50160164 missense probably benign 0.00
IGL02553:Hsd17b4 APN 18 50162097 splice site probably benign
IGL02813:Hsd17b4 APN 18 50128348 utr 5 prime probably benign
I0000:Hsd17b4 UTSW 18 50160228 missense probably benign 0.09
IGL02980:Hsd17b4 UTSW 18 50146518 missense probably benign 0.06
R0352:Hsd17b4 UTSW 18 50191784 missense probably benign
R0734:Hsd17b4 UTSW 18 50170777 missense possibly damaging 0.90
R0967:Hsd17b4 UTSW 18 50183261 missense probably benign 0.00
R1418:Hsd17b4 UTSW 18 50130187 splice site probably benign
R1661:Hsd17b4 UTSW 18 50160215 missense probably benign
R1665:Hsd17b4 UTSW 18 50160215 missense probably benign
R1752:Hsd17b4 UTSW 18 50170767 missense probably benign 0.27
R1804:Hsd17b4 UTSW 18 50177984 missense probably damaging 1.00
R2197:Hsd17b4 UTSW 18 50183302 splice site probably null
R4405:Hsd17b4 UTSW 18 50128314 start gained probably benign
R4976:Hsd17b4 UTSW 18 50160135 missense probably damaging 1.00
R5788:Hsd17b4 UTSW 18 50173709 missense probably damaging 0.99
R5826:Hsd17b4 UTSW 18 50183172 missense probably benign 0.00
R5889:Hsd17b4 UTSW 18 50177209 missense probably damaging 1.00
R6475:Hsd17b4 UTSW 18 50172262 intron probably null
R6632:Hsd17b4 UTSW 18 50179102 missense possibly damaging 0.70
R7151:Hsd17b4 UTSW 18 50128370 missense probably damaging 1.00
R7367:Hsd17b4 UTSW 18 50155185 missense probably damaging 1.00
R7383:Hsd17b4 UTSW 18 50164850 missense probably benign 0.13
R7397:Hsd17b4 UTSW 18 50146424 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGAGGAAGGTGTGACC -3'
(R):5'- TTCAAGAACTTCCGCAAATGAC -3'

Sequencing Primer
(F):5'- TTCTGGGGGACTTTTAAAAAGC -3'
(R):5'- AGAACTTCCGCAAATGACTTAAC -3'
Posted On2015-07-07