Incidental Mutation 'R2510:Vmn2r-ps159'
ID328542
Institutional Source Beutler Lab
Gene Symbol Vmn2r-ps159
Ensembl Gene ENSMUSG00000057021
Gene Namevomeronasal 2, receptor, pseudogene 159
SynonymsV2r8, Vmn2r-ps160, V2r9
MMRRC Submission 040416-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.825) question?
Stock #R2510 (G1)
Quality Score48
Status Validated
Chromosome4
Chromosomal Location156331103-156339499 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) G to T at 156334397 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000074107
SMART Domains Protein: ENSMUSP00000128975
Gene: ENSMUSG00000057021

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 423 1.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000096792
SMART Domains Protein: ENSMUSP00000094554
Gene: ENSMUSG00000057021

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 441 3.7e-31 PFAM
Pfam:NCD3G 510 563 1.4e-20 PFAM
Pfam:7tm_3 596 831 1.9e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189559
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
4930571K23Rik C A 7: 125,369,139 noncoding transcript Het
Adra1d C A 2: 131,562,135 E12* probably null Het
Ago4 A T 4: 126,517,071 D208E probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Atxn2 C T 5: 121,781,393 S388L probably damaging Het
Bbox1 A T 2: 110,305,631 M1K probably null Het
Btaf1 G A 19: 37,002,445 R1538H probably benign Het
Car11 G A 7: 45,701,359 G93E probably damaging Het
Col18a1 A G 10: 77,096,268 L329P unknown Het
Copb2 T A 9: 98,571,648 probably benign Het
Dnah2 G T 11: 69,524,206 S234* probably null Het
Dnah9 T C 11: 66,005,169 Y2460C probably damaging Het
Dnaic2 G C 11: 114,757,167 probably benign Het
Dst C A 1: 34,212,286 T1814K probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fancm A T 12: 65,113,770 probably benign Het
Fsip2 T C 2: 82,986,438 S4172P probably benign Het
G530012D18Rik T G 1: 85,577,204 probably benign Het
Gca T G 2: 62,689,974 S159R probably damaging Het
Gja8 T G 3: 96,919,717 T210P probably damaging Het
Gm10639 T A 9: 78,294,807 M1K probably null Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5117 T A 8: 31,738,355 noncoding transcript Het
Gm5900 T A 7: 104,950,364 noncoding transcript Het
Gpi1 A G 7: 34,205,923 S359P probably damaging Het
Grm5 A G 7: 88,036,091 E472G probably benign Het
Hoxd12 G A 2: 74,675,471 A129T possibly damaging Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Ift140 T C 17: 25,036,308 I466T probably benign Het
Kansl2 A G 15: 98,528,861 probably null Het
Kat2a T C 11: 100,712,142 Q88R probably benign Het
Kcnh7 T C 2: 62,721,917 D910G probably benign Het
Klk1b1 T C 7: 43,969,379 V60A probably damaging Het
Krt7 A C 15: 101,412,657 I62L probably benign Het
Llgl1 A G 11: 60,710,036 K653E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mafb T G 2: 160,366,576 E34A probably damaging Het
Meiob T C 17: 24,816,597 probably benign Het
Mllt10 C A 2: 18,065,124 D30E possibly damaging Het
Mprip T A 11: 59,749,508 probably benign Het
Muc5b A T 7: 141,859,061 N1915Y unknown Het
Mycbp2 C T 14: 103,155,255 R3290Q probably damaging Het
Obscn G A 11: 59,042,314 probably benign Het
Olfm3 T A 3: 115,122,310 V277D probably damaging Het
Olfr1271 C T 2: 90,265,606 V275I probably damaging Het
Olfr1286 G A 2: 111,420,451 P167S possibly damaging Het
Olfr668 G A 7: 104,925,687 H26Y probably benign Het
Olfr960 T A 9: 39,623,431 F101I probably damaging Het
Omp A T 7: 98,145,345 M25K possibly damaging Het
Otoa C T 7: 121,160,472 T1099I probably benign Het
Pcdh15 T G 10: 74,631,499 S1715A probably benign Het
Pcnx4 T C 12: 72,566,972 W564R probably damaging Het
Pde12 T C 14: 26,665,526 *609W probably null Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Plppr4 G T 3: 117,331,706 N161K probably damaging Het
Ppp1r37 T C 7: 19,532,432 K470E possibly damaging Het
Ptprd C A 4: 76,086,011 probably null Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rims2 T G 15: 39,585,652 S1217R probably damaging Het
Rorc C T 3: 94,389,120 T208I probably benign Het
Ryr3 C T 2: 112,675,904 E3458K probably benign Het
Scn5a A T 9: 119,533,685 V623E probably benign Het
Slc28a2 C T 2: 122,451,016 Q229* probably null Het
Slc35f3 C T 8: 126,298,706 probably benign Het
Spg11 T G 2: 122,075,310 I1285L probably benign Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Susd1 A T 4: 59,349,855 V527E possibly damaging Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Ttn T C 2: 76,740,992 D26519G probably damaging Het
Vmn1r215 A G 13: 23,076,173 I128V probably benign Het
Vmn1r37 T C 6: 66,731,951 L150P probably damaging Het
Vmn2r52 G T 7: 10,170,868 A348E probably benign Het
Wdyhv1 C A 15: 58,153,624 A145D probably damaging Het
Ypel5 T C 17: 72,846,391 L30P probably damaging Het
Zfp985 A G 4: 147,582,986 T104A possibly damaging Het
Other mutations in Vmn2r-ps159
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Vmn2r-ps159 APN 4 156334196 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338435 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338460 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334263 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334397 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156334562 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338484 exon noncoding transcript
IGL00990:Vmn2r-ps159 APN 4 156338146 splice site noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156338435 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156334263 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156335590 intron noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156334605 exon noncoding transcript
IGL01018:Vmn2r-ps159 APN 4 156338146 splice site noncoding transcript
IGL01829:Vmn2r-ps159 APN 4 156333319 intron noncoding transcript
IGL01863:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01864:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01865:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01866:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01868:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01869:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01872:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01873:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01876:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01877:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01878:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01879:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01880:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01884:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01885:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01886:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01887:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01888:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01890:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01891:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01893:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01894:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01896:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01897:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01898:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01899:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01901:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01902:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01903:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01904:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01905:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01906:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01907:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01908:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01909:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01913:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01915:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01916:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01917:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01918:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01919:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01920:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01921:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01922:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01923:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01927:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01928:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01929:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01930:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01931:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01932:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01935:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01937:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01939:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01941:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01942:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01944:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01945:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01946:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01949:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01953:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01954:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01956:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL01957:Vmn2r-ps159 APN 4 156338254 exon noncoding transcript
IGL02270:Vmn2r-ps159 APN 4 156334655 exon noncoding transcript
R1746:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R1870:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R2147:Vmn2r-ps159 UTSW 4 156334719 critical splice donor site noncoding transcript
R2168:Vmn2r-ps159 UTSW 4 156338378 exon noncoding transcript
R2345:Vmn2r-ps159 UTSW 4 156337039 splice site noncoding transcript
R2899:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3106:Vmn2r-ps159 UTSW 4 156333435 intron noncoding transcript
R3122:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3405:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3430:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3732:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R3751:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4108:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4112:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4120:Vmn2r-ps159 UTSW 4 156334483 exon noncoding transcript
R4135:Vmn2r-ps159 UTSW 4 156338790 exon noncoding transcript
R4302:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R4475:Vmn2r-ps159 UTSW 4 156338790 exon noncoding transcript
R4840:Vmn2r-ps159 UTSW 4 156333438 intron noncoding transcript
R4872:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R5144:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R5271:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
R5625:Vmn2r-ps159 UTSW 4 156334210 exon noncoding transcript
R5775:Vmn2r-ps159 UTSW 4 156334397 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ATGACATCTTCAGCAAAGGTTG -3'
(R):5'- AAACTGTAACCTTCATCACTCATCG -3'

Sequencing Primer
(F):5'- GACATCTTCAGCAAAGGTTGTTATC -3'
(R):5'- CGCCATATCATAGTTGTGCAG -3'
Posted On2015-07-17