Incidental Mutation 'R4430:0610040J01Rik'
List |< first << previous [record 73 of 386652] next >> last >|
ID328558
Institutional Source Beutler Lab
Gene Symbol 0610040J01Rik
Ensembl Gene ENSMUSG00000060512
Gene NameRIKEN cDNA 0610040J01 gene
Synonyms
MMRRC Submission 041700-MU
Accession Numbers
Stock #R4430 (G1)
Quality Score198
Status Not validated
Chromosome5
Chromosomal Location63812495-63899619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 63898839 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 306 (G306V)
Ref Sequence ENSEMBL: ENSMUSP00000080443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081747]
Predicted Effect unknown
Transcript: ENSMUST00000081747
AA Change: G306V
SMART Domains Protein: ENSMUSP00000080443
Gene: ENSMUSG00000060512
AA Change: G306V

DomainStartEndE-ValueType
Pfam:DUF4699 9 313 2.5e-123 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 A G 6: 86,986,366 N926S unknown Het
Ahi1 T A 10: 20,972,078 C462S probably damaging Het
Ahnak A G 19: 9,003,040 I563V probably benign Het
Ankrd55 G A 13: 112,323,183 probably null Het
Bag3 A G 7: 128,523,923 D22G probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col15a1 T C 4: 47,245,705 F152S probably damaging Het
Cxcr2 T C 1: 74,158,845 I166T probably benign Het
Dnah11 T C 12: 117,983,011 I3113V probably benign Het
Gli2 T C 1: 118,837,244 H1059R probably benign Het
Gm14412 C A 2: 177,315,832 S90I probably benign Het
L1td1 A G 4: 98,737,151 R528G probably benign Het
Mcm3 A T 1: 20,811,993 L449* probably null Het
Mif4gd T C 11: 115,608,502 T185A probably benign Het
Mphosph9 T C 5: 124,265,446 S840G possibly damaging Het
Nim1k C A 13: 119,712,542 R272L possibly damaging Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1457 C T 19: 13,095,088 V187I probably benign Het
Olfr806 T A 10: 129,738,261 I219F probably damaging Het
Pax3 A G 1: 78,195,324 V83A probably damaging Het
Pde3b C T 7: 114,534,670 P974S probably damaging Het
Pdzd3 C T 9: 44,249,744 S175N probably benign Het
Pglyrp3 T A 3: 92,031,491 D324E probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Ryr2 A G 13: 11,735,527 S1953P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox5 A G 6: 144,041,274 I188T possibly damaging Het
Spata4 T C 8: 54,601,843 I86T probably benign Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Stk10 T C 11: 32,533,552 V50A not run Het
Sytl4 A G,T X: 133,949,223 S338R probably damaging Homo
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem201 A C 4: 149,731,139 V118G probably benign Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Ugt2b37 T C 5: 87,254,092 M227V probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r73 A T 7: 85,870,241 M503K probably benign Het
Zfp54 T G 17: 21,434,960 V572G probably damaging Het
Other mutations in 0610040J01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:0610040J01Rik APN 5 63898383 missense possibly damaging 0.79
IGL02229:0610040J01Rik APN 5 63898353 missense probably damaging 0.99
IGL02389:0610040J01Rik APN 5 63896483 unclassified probably null 1.00
IGL02411:0610040J01Rik APN 5 63898116 missense probably benign 0.31
R0243:0610040J01Rik UTSW 5 63898463 missense probably benign 0.10
R0411:0610040J01Rik UTSW 5 63896491 splice site probably benign
R1978:0610040J01Rik UTSW 5 63898537 nonsense probably null
R2072:0610040J01Rik UTSW 5 63898737 missense possibly damaging 0.83
R2202:0610040J01Rik UTSW 5 63898668 missense possibly damaging 0.91
R3161:0610040J01Rik UTSW 5 63896490 splice site probably benign
R3162:0610040J01Rik UTSW 5 63896490 splice site probably benign
R4428:0610040J01Rik UTSW 5 63898839 missense unknown
R4429:0610040J01Rik UTSW 5 63898839 missense unknown
R4431:0610040J01Rik UTSW 5 63898839 missense unknown
R4464:0610040J01Rik UTSW 5 63898839 missense unknown
R4465:0610040J01Rik UTSW 5 63898839 missense unknown
R4467:0610040J01Rik UTSW 5 63898839 missense unknown
R4491:0610040J01Rik UTSW 5 63898469 missense probably damaging 1.00
R5161:0610040J01Rik UTSW 5 63898001 nonsense probably null
R6115:0610040J01Rik UTSW 5 63897974 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGCTGGGACTCACTGAATG -3'
(R):5'- TGCCCTATACAGCAAGCAG -3'

Sequencing Primer
(F):5'- TCACTGAATGAGGCAGGGACC -3'
(R):5'- GAGTAGGCACATGCTTCT -3'
Posted OnJul 21, 2015