Incidental Mutation 'R4430:Sost'
ID328574
Institutional Source Beutler Lab
Gene Symbol Sost
Ensembl Gene ENSMUSG00000001494
Gene Namesclerostin
Synonyms5430411E23Rik
MMRRC Submission 041700-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R4430 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101962458-101967015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101966844 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 44 (P44S)
Ref Sequence ENSEMBL: ENSMUSP00000001534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001534] [ENSMUST00000003612] [ENSMUST00000107172] [ENSMUST00000107173] [ENSMUST00000151678]
Predicted Effect probably damaging
Transcript: ENSMUST00000001534
AA Change: P44S

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001534
Gene: ENSMUSG00000001494
AA Change: P44S

DomainStartEndE-ValueType
Pfam:Sclerostin 1 208 8e-98 PFAM
Pfam:DAN 51 168 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000003612
SMART Domains Protein: ENSMUSP00000003612
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107172
SMART Domains Protein: ENSMUSP00000102790
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107173
SMART Domains Protein: ENSMUSP00000102791
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 54 201 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151678
SMART Domains Protein: ENSMUSP00000135384
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 3 108 6.99e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176599
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sclerostin is a secreted glycoprotein with a C-terminal cysteine knot-like (CTCK) domain and sequence similarity to the DAN (differential screening-selected gene aberrative in neuroblastoma) family of bone morphogenetic protein (BMP) antagonists. Loss-of-function mutations in this gene are associated with an autosomal-recessive disorder, sclerosteosis, which causes progressive bone overgrowth. A deletion downstream of this gene, which causes reduced sclerostin expression, is associated with a milder form of the disorder called van Buchem disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit an increase in trabecular and cortical bone volume, mineral density, and formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Aak1 A G 6: 86,986,366 N926S unknown Het
Ahi1 T A 10: 20,972,078 C462S probably damaging Het
Ahnak A G 19: 9,003,040 I563V probably benign Het
Ankrd55 G A 13: 112,323,183 probably null Het
Bag3 A G 7: 128,523,923 D22G probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Col15a1 T C 4: 47,245,705 F152S probably damaging Het
Cxcr2 T C 1: 74,158,845 I166T probably benign Het
Dnah11 T C 12: 117,983,011 I3113V probably benign Het
Gli2 T C 1: 118,837,244 H1059R probably benign Het
Gm14412 C A 2: 177,315,832 S90I probably benign Het
L1td1 A G 4: 98,737,151 R528G probably benign Het
Mcm3 A T 1: 20,811,993 L449* probably null Het
Mif4gd T C 11: 115,608,502 T185A probably benign Het
Mphosph9 T C 5: 124,265,446 S840G possibly damaging Het
Nim1k C A 13: 119,712,542 R272L possibly damaging Het
Olfr1079 A G 2: 86,538,387 I176T probably damaging Het
Olfr1457 C T 19: 13,095,088 V187I probably benign Het
Olfr806 T A 10: 129,738,261 I219F probably damaging Het
Pax3 A G 1: 78,195,324 V83A probably damaging Het
Pde3b C T 7: 114,534,670 P974S probably damaging Het
Pdzd3 C T 9: 44,249,744 S175N probably benign Het
Pglyrp3 T A 3: 92,031,491 D324E probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Ryr2 A G 13: 11,735,527 S1953P probably damaging Het
Sox5 A G 6: 144,041,274 I188T possibly damaging Het
Spata4 T C 8: 54,601,843 I86T probably benign Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Stk10 T C 11: 32,533,552 V50A possibly damaging Het
Sytl4 A G,T X: 133,949,223 S338R probably damaging Homo
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem201 A C 4: 149,731,139 V118G probably benign Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trhde A T 10: 114,503,123 L594Q probably damaging Het
Ugt2b37 T C 5: 87,254,092 M227V probably benign Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vmn2r73 A T 7: 85,870,241 M503K probably benign Het
Zfp54 T G 17: 21,434,960 V572G probably damaging Het
Other mutations in Sost
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Sost APN 11 101966879 missense probably damaging 1.00
IGL02487:Sost APN 11 101966807 missense possibly damaging 0.64
IGL02967:Sost APN 11 101964258 missense possibly damaging 0.50
R0724:Sost UTSW 11 101966918 missense probably benign 0.04
R1873:Sost UTSW 11 101964243 missense probably damaging 1.00
R2182:Sost UTSW 11 101963850 missense probably damaging 1.00
R3429:Sost UTSW 11 101964039 missense probably damaging 1.00
R4428:Sost UTSW 11 101966844 missense probably damaging 0.97
R4464:Sost UTSW 11 101966844 missense probably damaging 0.97
R4537:Sost UTSW 11 101966844 missense probably damaging 0.97
R4539:Sost UTSW 11 101966844 missense probably damaging 0.97
R4540:Sost UTSW 11 101966844 missense probably damaging 0.97
R4541:Sost UTSW 11 101966844 missense probably damaging 0.97
R4542:Sost UTSW 11 101966844 missense probably damaging 0.97
R4710:Sost UTSW 11 101966844 missense probably damaging 0.97
R5125:Sost UTSW 11 101963941 missense probably damaging 1.00
R7297:Sost UTSW 11 101964103 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAATGTGTCCCTGCCCTGATG -3'
(R):5'- AACCGTATCTAGGCTGGACAC -3'

Sequencing Primer
(F):5'- TGCCCTGATGTAGCAGAGG -3'
(R):5'- TATCTAGGCTGGACACTGGAGC -3'
Posted On2015-07-21