Incidental Mutation 'R4431:Olfr1243'
ID328595
Institutional Source Beutler Lab
Gene Symbol Olfr1243
Ensembl Gene ENSMUSG00000075084
Gene Nameolfactory receptor 1243
SynonymsGA_x6K02T2Q125-50972538-50971621, MOR231-4
MMRRC Submission 041146-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4431 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89525889-89531487 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89527643 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 256 (Y256H)
Ref Sequence ENSEMBL: ENSMUSP00000149464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099775] [ENSMUST00000144885]
Predicted Effect probably damaging
Transcript: ENSMUST00000099775
AA Change: Y256H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097363
Gene: ENSMUSG00000075084
AA Change: Y256H

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.5e-45 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.2e-5 PFAM
Pfam:7tm_1 39 285 2.1e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144885
AA Change: Y256H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216635
Meta Mutation Damage Score 0.0264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
2510039O18Rik T C 4: 147,941,565 S181P probably benign Het
4930522L14Rik A T 5: 109,736,574 C473S possibly damaging Het
4930523C07Rik A T 1: 160,044,579 noncoding transcript Het
9230110C19Rik A G 9: 8,027,177 V120A probably damaging Het
Aak1 A G 6: 86,986,318 K910R unknown Het
Abca2 A G 2: 25,442,852 D1521G probably benign Het
Adamts20 C A 15: 94,344,043 D695Y probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bspry T A 4: 62,482,667 I132N possibly damaging Het
Cfh T C 1: 140,136,266 Y424C probably damaging Het
Chd2 T C 7: 73,435,961 R1642G possibly damaging Het
Chrm2 A G 6: 36,524,162 D318G probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fbxo42 C A 4: 141,200,550 R714S probably damaging Het
Fmo1 G A 1: 162,833,712 A334V possibly damaging Het
Gpr68 A T 12: 100,899,391 probably benign Het
Gramd4 A G 15: 86,130,160 K345R probably damaging Het
Gtpbp1 T G 15: 79,716,197 S444A probably damaging Het
Ints12 T C 3: 133,102,481 Y207H probably damaging Het
Kat2b-ps A T 5: 93,392,584 noncoding transcript Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Lamc1 A G 1: 153,221,528 I1590T probably damaging Het
Lhfpl4 A G 6: 113,193,844 I127T possibly damaging Het
Lrrc71 A G 3: 87,742,836 S286P possibly damaging Het
Man1c1 A T 4: 134,703,018 V151D probably damaging Het
Mipol1 G A 12: 57,303,524 R36Q possibly damaging Het
Nuggc T A 14: 65,611,210 W187R probably benign Het
Pkhd1 G A 1: 20,523,314 T1525I probably damaging Het
Pomp A G 5: 147,875,479 E125G probably damaging Het
Ptar1 G T 19: 23,694,331 G33C probably damaging Het
Ptpn3 A G 4: 57,235,355 S335P probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Shank1 C T 7: 44,319,652 R324* probably null Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slc12a9 G A 5: 137,321,513 P580L probably benign Het
Spz1 A G 13: 92,575,329 L213P probably damaging Het
Strn A G 17: 78,736,462 V9A probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trf T C 9: 103,211,876 N243S possibly damaging Het
Ttc3 T C 16: 94,410,958 probably null Het
Uhrf1bp1 A G 17: 27,885,931 N533S probably damaging Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vps13b A C 15: 35,770,753 Q2114P probably damaging Het
Wdfy1 T A 1: 79,713,866 R275* probably null Het
Wnt2b A G 3: 104,952,940 L217S probably damaging Het
Other mutations in Olfr1243
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Olfr1243 APN 2 89528207 missense probably damaging 1.00
IGL01940:Olfr1243 APN 2 89527810 missense probably damaging 0.99
IGL02553:Olfr1243 APN 2 89527931 missense probably benign
R0105:Olfr1243 UTSW 2 89528363 missense probably benign 0.00
R0105:Olfr1243 UTSW 2 89528363 missense probably benign 0.00
R0607:Olfr1243 UTSW 2 89528107 missense possibly damaging 0.88
R0764:Olfr1243 UTSW 2 89527996 missense probably benign 0.05
R1779:Olfr1243 UTSW 2 89527645 missense probably benign 0.15
R2221:Olfr1243 UTSW 2 89527937 missense probably benign 0.05
R3853:Olfr1243 UTSW 2 89527573 missense possibly damaging 0.94
R3886:Olfr1243 UTSW 2 89527732 missense possibly damaging 0.81
R3887:Olfr1243 UTSW 2 89527732 missense possibly damaging 0.81
R3888:Olfr1243 UTSW 2 89527732 missense possibly damaging 0.81
R4479:Olfr1243 UTSW 2 89528170 missense possibly damaging 0.89
R6807:Olfr1243 UTSW 2 89527588 missense probably damaging 1.00
R7025:Olfr1243 UTSW 2 89527604 missense probably damaging 0.98
R7094:Olfr1243 UTSW 2 89527558 missense probably damaging 1.00
R7144:Olfr1243 UTSW 2 89527557 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACAGCATCCCTTGTTAG -3'
(R):5'- TCACTGTCATTGCCAATGGTG -3'

Sequencing Primer
(F):5'- GCACAGCATCCCTTGTTAGAATTTAC -3'
(R):5'- GGAGTAATCTGTGTGGGAATTTTCAC -3'
Posted On2015-07-21