Incidental Mutation 'R4431:Gpr68'
ID328624
Institutional Source Beutler Lab
Gene Symbol Gpr68
Ensembl Gene ENSMUSG00000047415
Gene NameG protein-coupled receptor 68
SynonymsOGR1
MMRRC Submission 041146-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4431 (G1)
Quality Score134
Status Validated
Chromosome12
Chromosomal Location100876682-100908198 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 100899391 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053668] [ENSMUST00000110065] [ENSMUST00000110066] [ENSMUST00000110070]
Predicted Effect probably benign
Transcript: ENSMUST00000053668
SMART Domains Protein: ENSMUSP00000057510
Gene: ENSMUSG00000047415

DomainStartEndE-ValueType
low complexity region 26 34 N/A INTRINSIC
Pfam:7tm_1 38 286 2.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110065
SMART Domains Protein: ENSMUSP00000105692
Gene: ENSMUSG00000047415

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 29 162 3e-6 PFAM
Pfam:7tm_1 38 286 1.8e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110066
SMART Domains Protein: ENSMUSP00000105693
Gene: ENSMUSG00000047415

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 29 162 3e-6 PFAM
Pfam:7tm_1 38 286 1.8e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110070
SMART Domains Protein: ENSMUSP00000105697
Gene: ENSMUSG00000021185

DomainStartEndE-ValueType
Pfam:DUF1445 115 257 2.8e-51 PFAM
Pfam:DUF4392 298 563 2.5e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128306
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222453
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor for sphingosylphosphorylcholine. The encoded protein is a proton-sensing receptor, inactive at pH 7.8 but active at pH 6.8. Mutations in this gene are a cause of amelogenesis imperfecta. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased osteoclastogenesis, abnormal pH-sensitive osteoclast survival, and background sensitive alterations in brown adipose tissue, monocytes, and macrophages. Mice homozygous for a different allele exhibit attenuated glucose-stimulated insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
2510039O18Rik T C 4: 147,941,565 S181P probably benign Het
4930522L14Rik A T 5: 109,736,574 C473S possibly damaging Het
4930523C07Rik A T 1: 160,044,579 noncoding transcript Het
9230110C19Rik A G 9: 8,027,177 V120A probably damaging Het
Aak1 A G 6: 86,986,318 K910R unknown Het
Abca2 A G 2: 25,442,852 D1521G probably benign Het
Adamts20 C A 15: 94,344,043 D695Y probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bspry T A 4: 62,482,667 I132N possibly damaging Het
Cfh T C 1: 140,136,266 Y424C probably damaging Het
Chd2 T C 7: 73,435,961 R1642G possibly damaging Het
Chrm2 A G 6: 36,524,162 D318G probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fbxo42 C A 4: 141,200,550 R714S probably damaging Het
Fmo1 G A 1: 162,833,712 A334V possibly damaging Het
Gramd4 A G 15: 86,130,160 K345R probably damaging Het
Gtpbp1 T G 15: 79,716,197 S444A probably damaging Het
Ints12 T C 3: 133,102,481 Y207H probably damaging Het
Kat2b-ps A T 5: 93,392,584 noncoding transcript Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Lamc1 A G 1: 153,221,528 I1590T probably damaging Het
Lhfpl4 A G 6: 113,193,844 I127T possibly damaging Het
Lrrc71 A G 3: 87,742,836 S286P possibly damaging Het
Man1c1 A T 4: 134,703,018 V151D probably damaging Het
Mipol1 G A 12: 57,303,524 R36Q possibly damaging Het
Nuggc T A 14: 65,611,210 W187R probably benign Het
Olfr1243 A G 2: 89,527,643 Y256H probably damaging Het
Pkhd1 G A 1: 20,523,314 T1525I probably damaging Het
Pomp A G 5: 147,875,479 E125G probably damaging Het
Ptar1 G T 19: 23,694,331 G33C probably damaging Het
Ptpn3 A G 4: 57,235,355 S335P probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Shank1 C T 7: 44,319,652 R324* probably null Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slc12a9 G A 5: 137,321,513 P580L probably benign Het
Spz1 A G 13: 92,575,329 L213P probably damaging Het
Strn A G 17: 78,736,462 V9A probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trf T C 9: 103,211,876 N243S possibly damaging Het
Ttc3 T C 16: 94,410,958 probably null Het
Uhrf1bp1 A G 17: 27,885,931 N533S probably damaging Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vps13b A C 15: 35,770,753 Q2114P probably damaging Het
Wdfy1 T A 1: 79,713,866 R275* probably null Het
Wnt2b A G 3: 104,952,940 L217S probably damaging Het
Other mutations in Gpr68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02368:Gpr68 APN 12 100878767 missense probably damaging 1.00
R0581:Gpr68 UTSW 12 100878556 missense probably damaging 1.00
R1800:Gpr68 UTSW 12 100878908 missense probably damaging 1.00
R1819:Gpr68 UTSW 12 100878403 missense possibly damaging 0.55
R1875:Gpr68 UTSW 12 100878790 missense probably damaging 1.00
R4029:Gpr68 UTSW 12 100879216 missense probably damaging 1.00
R4030:Gpr68 UTSW 12 100879216 missense probably damaging 1.00
R5000:Gpr68 UTSW 12 100878337 missense probably benign 0.04
R5770:Gpr68 UTSW 12 100878821 missense probably benign 0.00
R6812:Gpr68 UTSW 12 100878411 missense probably damaging 1.00
R7217:Gpr68 UTSW 12 100878799 missense possibly damaging 0.91
X0018:Gpr68 UTSW 12 100878869 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GTAAGCCAGCGACCAGTAAC -3'
(R):5'- GAAGTCCCCTAGTGCTTCAG -3'

Sequencing Primer
(F):5'- GCGACCAGTAACCATGGC -3'
(R):5'- AGCTTGGCTTCTTCCGCAGAG -3'
Posted On2015-07-21