Incidental Mutation 'R4431:Uhrf1bp1'
ID328634
Institutional Source Beutler Lab
Gene Symbol Uhrf1bp1
Ensembl Gene ENSMUSG00000039512
Gene NameUHRF1 (ICBP90) binding protein 1
Synonyms1110020K19Rik, F830021D11Rik
MMRRC Submission 041146-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4431 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location27856490-27900040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27885931 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 533 (N533S)
Ref Sequence ENSEMBL: ENSMUSP00000110499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114849]
Predicted Effect probably damaging
Transcript: ENSMUST00000114849
AA Change: N533S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110499
Gene: ENSMUSG00000039512
AA Change: N533S

DomainStartEndE-ValueType
Pfam:Chorein_N 1 104 2.6e-18 PFAM
low complexity region 234 247 N/A INTRINSIC
low complexity region 297 306 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
low complexity region 1200 1216 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1375 1386 N/A INTRINSIC
coiled coil region 1394 1424 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137825
Meta Mutation Damage Score 0.328 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
2510039O18Rik T C 4: 147,941,565 S181P probably benign Het
4930522L14Rik A T 5: 109,736,574 C473S possibly damaging Het
4930523C07Rik A T 1: 160,044,579 noncoding transcript Het
9230110C19Rik A G 9: 8,027,177 V120A probably damaging Het
Aak1 A G 6: 86,986,318 K910R unknown Het
Abca2 A G 2: 25,442,852 D1521G probably benign Het
Adamts20 C A 15: 94,344,043 D695Y probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bspry T A 4: 62,482,667 I132N possibly damaging Het
Cfh T C 1: 140,136,266 Y424C probably damaging Het
Chd2 T C 7: 73,435,961 R1642G possibly damaging Het
Chrm2 A G 6: 36,524,162 D318G probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fbxo42 C A 4: 141,200,550 R714S probably damaging Het
Fmo1 G A 1: 162,833,712 A334V possibly damaging Het
Gpr68 A T 12: 100,899,391 probably benign Het
Gramd4 A G 15: 86,130,160 K345R probably damaging Het
Gtpbp1 T G 15: 79,716,197 S444A probably damaging Het
Ints12 T C 3: 133,102,481 Y207H probably damaging Het
Kat2b-ps A T 5: 93,392,584 noncoding transcript Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Lamc1 A G 1: 153,221,528 I1590T probably damaging Het
Lhfpl4 A G 6: 113,193,844 I127T possibly damaging Het
Lrrc71 A G 3: 87,742,836 S286P possibly damaging Het
Man1c1 A T 4: 134,703,018 V151D probably damaging Het
Mipol1 G A 12: 57,303,524 R36Q possibly damaging Het
Nuggc T A 14: 65,611,210 W187R probably benign Het
Olfr1243 A G 2: 89,527,643 Y256H probably damaging Het
Pkhd1 G A 1: 20,523,314 T1525I probably damaging Het
Pomp A G 5: 147,875,479 E125G probably damaging Het
Ptar1 G T 19: 23,694,331 G33C probably damaging Het
Ptpn3 A G 4: 57,235,355 S335P probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Shank1 C T 7: 44,319,652 R324* probably null Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slc12a9 G A 5: 137,321,513 P580L probably benign Het
Spz1 A G 13: 92,575,329 L213P probably damaging Het
Strn A G 17: 78,736,462 V9A probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trf T C 9: 103,211,876 N243S possibly damaging Het
Ttc3 T C 16: 94,410,958 probably null Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vps13b A C 15: 35,770,753 Q2114P probably damaging Het
Wdfy1 T A 1: 79,713,866 R275* probably null Het
Wnt2b A G 3: 104,952,940 L217S probably damaging Het
Other mutations in Uhrf1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Uhrf1bp1 APN 17 27876917 splice site probably benign
IGL00786:Uhrf1bp1 APN 17 27879292 missense probably damaging 0.99
IGL01074:Uhrf1bp1 APN 17 27879291 missense possibly damaging 0.94
IGL01780:Uhrf1bp1 APN 17 27893500 missense probably damaging 1.00
IGL02668:Uhrf1bp1 APN 17 27886575 missense possibly damaging 0.53
IGL02686:Uhrf1bp1 APN 17 27894589 missense probably benign
IGL03240:Uhrf1bp1 APN 17 27893253 missense probably benign 0.37
hades UTSW 17 27894746 missense probably damaging 1.00
R0167:Uhrf1bp1 UTSW 17 27880202 missense possibly damaging 0.46
R0240:Uhrf1bp1 UTSW 17 27895870 splice site probably benign
R0332:Uhrf1bp1 UTSW 17 27893294 critical splice donor site probably null
R0668:Uhrf1bp1 UTSW 17 27895939 missense probably benign 0.16
R0726:Uhrf1bp1 UTSW 17 27885489 missense possibly damaging 0.50
R0964:Uhrf1bp1 UTSW 17 27887178 missense probably damaging 0.96
R1125:Uhrf1bp1 UTSW 17 27893449 missense probably damaging 1.00
R1139:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1164:Uhrf1bp1 UTSW 17 27895380 critical splice donor site probably null
R1192:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1277:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1279:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1340:Uhrf1bp1 UTSW 17 27894721 missense probably benign 0.00
R1341:Uhrf1bp1 UTSW 17 27877419 splice site probably benign
R1344:Uhrf1bp1 UTSW 17 27894577 missense probably benign 0.41
R1418:Uhrf1bp1 UTSW 17 27894577 missense probably benign 0.41
R1552:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R1726:Uhrf1bp1 UTSW 17 27886251 splice site probably null
R1791:Uhrf1bp1 UTSW 17 27894746 missense probably damaging 1.00
R1796:Uhrf1bp1 UTSW 17 27890071 missense possibly damaging 0.87
R2858:Uhrf1bp1 UTSW 17 27885462 missense probably damaging 0.99
R3034:Uhrf1bp1 UTSW 17 27894746 missense probably damaging 1.00
R4111:Uhrf1bp1 UTSW 17 27886090 nonsense probably null
R4159:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4160:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4161:Uhrf1bp1 UTSW 17 27884087 missense probably damaging 1.00
R4575:Uhrf1bp1 UTSW 17 27887503 missense probably benign 0.02
R4657:Uhrf1bp1 UTSW 17 27890105 missense probably benign 0.09
R4666:Uhrf1bp1 UTSW 17 27893503 missense possibly damaging 0.95
R4825:Uhrf1bp1 UTSW 17 27877394 missense probably damaging 0.98
R4872:Uhrf1bp1 UTSW 17 27890136 missense probably benign 0.10
R4956:Uhrf1bp1 UTSW 17 27889984 intron probably null
R4976:Uhrf1bp1 UTSW 17 27884026 missense probably damaging 0.99
R4982:Uhrf1bp1 UTSW 17 27886606 missense probably benign 0.05
R5017:Uhrf1bp1 UTSW 17 27894739 nonsense probably null
R5033:Uhrf1bp1 UTSW 17 27886864 missense probably damaging 0.99
R5137:Uhrf1bp1 UTSW 17 27876990 intron probably null
R5159:Uhrf1bp1 UTSW 17 27881556 missense probably damaging 0.98
R5177:Uhrf1bp1 UTSW 17 27885018 missense possibly damaging 0.94
R5196:Uhrf1bp1 UTSW 17 27856763 missense probably benign 0.09
R5214:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5352:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5354:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5425:Uhrf1bp1 UTSW 17 27887515 missense probably benign
R5601:Uhrf1bp1 UTSW 17 27884494 missense probably damaging 1.00
R6080:Uhrf1bp1 UTSW 17 27880297 missense probably benign
R6088:Uhrf1bp1 UTSW 17 27884605 critical splice donor site probably null
R6331:Uhrf1bp1 UTSW 17 27893201 missense probably benign 0.01
R6529:Uhrf1bp1 UTSW 17 27879776 missense possibly damaging 0.90
R6614:Uhrf1bp1 UTSW 17 27876925 missense probably benign 0.18
R6701:Uhrf1bp1 UTSW 17 27887357 nonsense probably null
R7082:Uhrf1bp1 UTSW 17 27890065 missense probably damaging 1.00
R7158:Uhrf1bp1 UTSW 17 27886433 nonsense probably null
X0017:Uhrf1bp1 UTSW 17 27877341 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTTAAAACTGCCCTGGGGTG -3'
(R):5'- GGCCCTACCTTCAACCAGAATG -3'

Sequencing Primer
(F):5'- CAGAAGTTGATAGTCTCTCCAGG -3'
(R):5'- AACCAGAATGCGTCCAGTCGG -3'
Posted On2015-07-21