Incidental Mutation 'R4431:Strn'
ID328635
Institutional Source Beutler Lab
Gene Symbol Strn
Ensembl Gene ENSMUSG00000024077
Gene Namestriatin, calmodulin binding protein
Synonyms
MMRRC Submission 041146-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.461) question?
Stock #R4431 (G1)
Quality Score118
Status Validated
Chromosome17
Chromosomal Location78649913-78737196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78736462 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 9 (V9A)
Ref Sequence ENSEMBL: ENSMUSP00000120830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145910]
Predicted Effect probably damaging
Transcript: ENSMUST00000145910
AA Change: V9A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120830
Gene: ENSMUSG00000024077
AA Change: V9A

DomainStartEndE-ValueType
low complexity region 17 45 N/A INTRINSIC
Pfam:Striatin 48 177 4.2e-50 PFAM
low complexity region 238 254 N/A INTRINSIC
low complexity region 331 348 N/A INTRINSIC
low complexity region 376 384 N/A INTRINSIC
low complexity region 412 429 N/A INTRINSIC
WD40 452 491 6.04e-8 SMART
WD40 505 544 2.42e-7 SMART
WD40 558 597 1.21e-7 SMART
WD40 646 692 1.28e1 SMART
WD40 695 734 4.4e-10 SMART
WD40 737 780 2.48e-4 SMART
Meta Mutation Damage Score 0.226 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Mice heterozygous for a knock-out allele exhibit increased blood pressure and circulating aldosterone when fed a liberal salt diet. No mice could be generated that were homozygous for the allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
2510039O18Rik T C 4: 147,941,565 S181P probably benign Het
4930522L14Rik A T 5: 109,736,574 C473S possibly damaging Het
4930523C07Rik A T 1: 160,044,579 noncoding transcript Het
9230110C19Rik A G 9: 8,027,177 V120A probably damaging Het
Aak1 A G 6: 86,986,318 K910R unknown Het
Abca2 A G 2: 25,442,852 D1521G probably benign Het
Adamts20 C A 15: 94,344,043 D695Y probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bspry T A 4: 62,482,667 I132N possibly damaging Het
Cfh T C 1: 140,136,266 Y424C probably damaging Het
Chd2 T C 7: 73,435,961 R1642G possibly damaging Het
Chrm2 A G 6: 36,524,162 D318G probably benign Het
Chrna4 A G 2: 181,028,620 S448P probably damaging Het
Cldn8 A C 16: 88,562,731 M102R probably damaging Het
Dock8 T C 19: 25,065,390 V112A probably benign Het
Fbxo42 C A 4: 141,200,550 R714S probably damaging Het
Fmo1 G A 1: 162,833,712 A334V possibly damaging Het
Gpr68 A T 12: 100,899,391 probably benign Het
Gramd4 A G 15: 86,130,160 K345R probably damaging Het
Gtpbp1 T G 15: 79,716,197 S444A probably damaging Het
Ints12 T C 3: 133,102,481 Y207H probably damaging Het
Kat2b-ps A T 5: 93,392,584 noncoding transcript Het
Klhl25 T A 7: 75,865,414 F23I probably damaging Het
Lamc1 A G 1: 153,221,528 I1590T probably damaging Het
Lhfpl4 A G 6: 113,193,844 I127T possibly damaging Het
Lrrc71 A G 3: 87,742,836 S286P possibly damaging Het
Man1c1 A T 4: 134,703,018 V151D probably damaging Het
Mipol1 G A 12: 57,303,524 R36Q possibly damaging Het
Nuggc T A 14: 65,611,210 W187R probably benign Het
Olfr1243 A G 2: 89,527,643 Y256H probably damaging Het
Pkhd1 G A 1: 20,523,314 T1525I probably damaging Het
Pomp A G 5: 147,875,479 E125G probably damaging Het
Ptar1 G T 19: 23,694,331 G33C probably damaging Het
Ptpn3 A G 4: 57,235,355 S335P probably damaging Het
Pus7 A G 5: 23,746,489 Y521H probably benign Het
Shank1 C T 7: 44,319,652 R324* probably null Het
Slc12a3 A T 8: 94,343,085 I541F probably damaging Het
Slc12a9 G A 5: 137,321,513 P580L probably benign Het
Spz1 A G 13: 92,575,329 L213P probably damaging Het
Sytl5 A T X: 9,960,023 N412Y probably damaging Het
Tert T A 13: 73,627,475 F115Y probably damaging Het
Tmem67 T A 4: 12,051,473 N785I possibly damaging Het
Trf T C 9: 103,211,876 N243S possibly damaging Het
Ttc3 T C 16: 94,410,958 probably null Het
Uhrf1bp1 A G 17: 27,885,931 N533S probably damaging Het
Vmn2r22 T C 6: 123,637,858 T258A possibly damaging Het
Vps13b A C 15: 35,770,753 Q2114P probably damaging Het
Wdfy1 T A 1: 79,713,866 R275* probably null Het
Wnt2b A G 3: 104,952,940 L217S probably damaging Het
Other mutations in Strn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Strn APN 17 78692420 missense possibly damaging 0.89
IGL02165:Strn APN 17 78687620 missense probably damaging 1.00
IGL02424:Strn APN 17 78684351 missense probably damaging 1.00
IGL02473:Strn APN 17 78684293 missense possibly damaging 0.71
IGL03306:Strn APN 17 78667223 missense probably damaging 0.98
R0053:Strn UTSW 17 78656934 missense possibly damaging 0.92
R0053:Strn UTSW 17 78656934 missense possibly damaging 0.92
R0165:Strn UTSW 17 78677374 missense possibly damaging 0.89
R1156:Strn UTSW 17 78656931 missense probably damaging 0.99
R1191:Strn UTSW 17 78692426 missense possibly damaging 0.82
R1256:Strn UTSW 17 78664617 critical splice donor site probably null
R1700:Strn UTSW 17 78692402 missense probably damaging 1.00
R1878:Strn UTSW 17 78677326 missense possibly damaging 0.81
R1897:Strn UTSW 17 78682842 missense probably benign 0.01
R1912:Strn UTSW 17 78684395 missense probably damaging 1.00
R1975:Strn UTSW 17 78692499 intron probably null
R2357:Strn UTSW 17 78655599 missense probably damaging 1.00
R3054:Strn UTSW 17 78682892 missense probably damaging 0.99
R3693:Strn UTSW 17 78656992 missense probably damaging 1.00
R3694:Strn UTSW 17 78656992 missense probably damaging 1.00
R3695:Strn UTSW 17 78656992 missense probably damaging 1.00
R3941:Strn UTSW 17 78657940 missense probably damaging 0.99
R4570:Strn UTSW 17 78677372 missense possibly damaging 0.95
R4678:Strn UTSW 17 78677351 missense probably damaging 1.00
R4729:Strn UTSW 17 78657961 missense probably damaging 0.98
R4947:Strn UTSW 17 78661779 missense probably damaging 0.98
R5470:Strn UTSW 17 78656945 missense probably benign 0.01
R5710:Strn UTSW 17 78687599 missense probably damaging 1.00
R5943:Strn UTSW 17 78669847 missense probably damaging 0.96
R6173:Strn UTSW 17 78700869 missense probably damaging 1.00
R6800:Strn UTSW 17 78670358 intron probably benign
R6846:Strn UTSW 17 78736457 missense probably damaging 0.97
X0022:Strn UTSW 17 78700949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTGGAAGTGATGGGCGC -3'
(R):5'- ACTACATTTCCCGGCAAGCC -3'

Sequencing Primer
(F):5'- GAGGGTCTTTACCTGCAGCTC -3'
(R):5'- AGTTGACCCACTTCCCGG -3'
Posted On2015-07-21