Incidental Mutation 'R4432:Pcdhb15'
ID328672
Institutional Source Beutler Lab
Gene Symbol Pcdhb15
Ensembl Gene ENSMUSG00000047033
Gene Nameprotocadherin beta 15
SynonymsPcdhbO, Pcdhb7
MMRRC Submission 041701-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4432 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37473540-37476340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37475512 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 599 (N599S)
Ref Sequence ENSEMBL: ENSMUSP00000059598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050034] [ENSMUST00000051442] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000050034
AA Change: N599S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059598
Gene: ENSMUSG00000047033
AA Change: N599S

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 2.6e-33 PFAM
CA 155 240 7.79e-22 SMART
CA 264 345 4.37e-25 SMART
CA 368 449 4.4e-21 SMART
CA 473 559 7.38e-23 SMART
CA 589 670 4.48e-13 SMART
Pfam:Cadherin_C_2 686 770 5.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051442
SMART Domains Protein: ENSMUSP00000056347
Gene: ENSMUSG00000047910

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 46 132 7.7e-1 SMART
CA 156 241 1.93e-17 SMART
CA 265 346 4.2e-27 SMART
CA 369 450 1.08e-24 SMART
CA 474 560 3.31e-25 SMART
CA 590 671 2.87e-11 SMART
Pfam:Cadherin_C_2 687 770 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. The transcript for this particular family member uses more than one polyadenylation site. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,478 I51F probably damaging Het
Abca6 T C 11: 110,241,588 M294V probably benign Het
Abcc5 A T 16: 20,368,187 probably null Het
Acsm4 A C 7: 119,711,387 E499A probably damaging Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Anks6 G A 4: 47,044,905 Q334* probably null Het
Cadps2 T A 6: 23,626,738 I155L probably damaging Het
Casp4 G A 9: 5,323,653 R74H probably damaging Het
Cdk14 A G 5: 5,036,427 W298R probably damaging Het
Chia1 A G 3: 106,115,325 N12D probably benign Het
Cyp3a59 A G 5: 146,104,786 D380G probably benign Het
Dnm2 T C 9: 21,491,304 probably benign Het
Dnm3 T C 1: 161,991,997 probably benign Het
Dpp4 A G 2: 62,345,112 Y660H probably damaging Het
Fam92b C A 8: 120,174,855 R37L probably damaging Het
H6pd T G 4: 149,995,758 Y202S probably damaging Het
Hnrnpa0 T C 13: 58,127,937 K126R probably benign Het
Insc C T 7: 114,769,055 probably benign Het
Lrrc45 G A 11: 120,715,221 probably null Het
Mapkap1 T C 2: 34,619,863 L263P probably damaging Het
Nmur1 A G 1: 86,387,565 S160P probably damaging Het
Olfr1254 A T 2: 89,788,734 M206K possibly damaging Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Pcid2 T C 8: 13,085,421 D196G probably damaging Het
Pcolce2 T C 9: 95,681,557 F199L probably damaging Het
Phf11c A T 14: 59,390,935 N88K possibly damaging Het
Prl8a8 T A 13: 27,510,480 Y109F probably benign Het
Rasa2 A G 9: 96,542,407 probably benign Het
Samhd1 T C 2: 157,104,893 D558G probably damaging Het
Slc1a1 T C 19: 28,902,709 F263S probably benign Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc4a7 T A 14: 14,757,323 N520K probably damaging Het
Szt2 A G 4: 118,384,231 S1679P probably damaging Het
Vmn1r218 T C 13: 23,137,242 F173S possibly damaging Het
Vmn2r32 T A 7: 7,479,919 N19Y probably damaging Het
Other mutations in Pcdhb15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Pcdhb15 APN 18 37475154 missense probably damaging 1.00
IGL01536:Pcdhb15 APN 18 37474993 missense probably benign 0.01
IGL01664:Pcdhb15 APN 18 37474261 missense probably benign 0.35
IGL02001:Pcdhb15 APN 18 37474038 missense probably benign 0.01
IGL02161:Pcdhb15 APN 18 37475502 missense possibly damaging 0.78
IGL02205:Pcdhb15 APN 18 37473957 missense probably damaging 0.99
IGL02748:Pcdhb15 APN 18 37475220 missense probably damaging 0.98
IGL02828:Pcdhb15 APN 18 37473850 missense probably damaging 0.97
IGL02974:Pcdhb15 APN 18 37475014 missense probably damaging 1.00
IGL03119:Pcdhb15 APN 18 37475014 missense probably damaging 1.00
IGL03136:Pcdhb15 APN 18 37475014 missense probably damaging 1.00
IGL03150:Pcdhb15 APN 18 37475014 missense probably damaging 1.00
PIT1430001:Pcdhb15 UTSW 18 37475671 missense probably benign 0.15
R0266:Pcdhb15 UTSW 18 37475276 missense probably damaging 1.00
R0288:Pcdhb15 UTSW 18 37475398 missense probably damaging 1.00
R0399:Pcdhb15 UTSW 18 37474168 missense possibly damaging 0.56
R0400:Pcdhb15 UTSW 18 37475895 missense probably benign
R0554:Pcdhb15 UTSW 18 37474519 missense probably damaging 1.00
R0637:Pcdhb15 UTSW 18 37475566 missense probably damaging 1.00
R0714:Pcdhb15 UTSW 18 37474621 missense probably damaging 0.98
R1118:Pcdhb15 UTSW 18 37473762 missense probably benign 0.01
R1423:Pcdhb15 UTSW 18 37473922 missense probably damaging 0.97
R1672:Pcdhb15 UTSW 18 37474660 missense probably damaging 1.00
R1681:Pcdhb15 UTSW 18 37473813 missense probably damaging 1.00
R1779:Pcdhb15 UTSW 18 37476031 missense possibly damaging 0.95
R2206:Pcdhb15 UTSW 18 37475022 missense probably benign 0.05
R2207:Pcdhb15 UTSW 18 37475022 missense probably benign 0.05
R2274:Pcdhb15 UTSW 18 37475443 missense probably damaging 1.00
R3406:Pcdhb15 UTSW 18 37475389 missense probably benign 0.41
R3407:Pcdhb15 UTSW 18 37474389 missense possibly damaging 0.80
R3417:Pcdhb15 UTSW 18 37475163 missense probably damaging 1.00
R3752:Pcdhb15 UTSW 18 37473757 missense probably damaging 1.00
R3773:Pcdhb15 UTSW 18 37475890 missense probably benign 0.00
R4433:Pcdhb15 UTSW 18 37475512 missense probably damaging 1.00
R4583:Pcdhb15 UTSW 18 37475575 missense possibly damaging 0.91
R4612:Pcdhb15 UTSW 18 37475595 missense probably damaging 0.96
R4988:Pcdhb15 UTSW 18 37475802 missense probably damaging 0.98
R5635:Pcdhb15 UTSW 18 37473770 nonsense probably null
R5692:Pcdhb15 UTSW 18 37474449 missense probably benign 0.01
R5742:Pcdhb15 UTSW 18 37474767 missense probably damaging 0.99
R5913:Pcdhb15 UTSW 18 37474654 missense probably benign 0.07
R6350:Pcdhb15 UTSW 18 37475361 missense probably damaging 1.00
R6522:Pcdhb15 UTSW 18 37474261 missense probably benign 0.35
R6676:Pcdhb15 UTSW 18 37474807 missense possibly damaging 0.60
R6693:Pcdhb15 UTSW 18 37474341 missense probably benign 0.01
R6905:Pcdhb15 UTSW 18 37474695 missense possibly damaging 0.95
R7029:Pcdhb15 UTSW 18 37475568 missense possibly damaging 0.85
R7335:Pcdhb15 UTSW 18 37474336 missense probably damaging 1.00
X0062:Pcdhb15 UTSW 18 37476015 nonsense probably null
X0063:Pcdhb15 UTSW 18 37475084 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTTCCACGTGGGTGCAATAG -3'
(R):5'- TGAGAGAAGCCATCGACCAG -3'

Sequencing Primer
(F):5'- GGTGCAATAGACCAAGGCTCC -3'
(R):5'- GCCATCGACCAGCAACACATG -3'
Posted On2015-07-21