Incidental Mutation 'R4433:Ak5'
ID328686
Institutional Source Beutler Lab
Gene Symbol Ak5
Ensembl Gene ENSMUSG00000039058
Gene Nameadenylate kinase 5
Synonyms
MMRRC Submission 041147-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R4433 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location152462815-152668360 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152655880 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 135 (I135T)
Ref Sequence ENSEMBL: ENSMUSP00000042785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045262]
Predicted Effect probably damaging
Transcript: ENSMUST00000045262
AA Change: I135T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042785
Gene: ENSMUSG00000039058
AA Change: I135T

DomainStartEndE-ValueType
Pfam:AAA_17 134 263 1.1e-8 PFAM
Pfam:AAA_18 135 274 3e-10 PFAM
Pfam:ADK 137 294 5.8e-35 PFAM
Pfam:AAA_17 378 525 2.9e-8 PFAM
Pfam:ADK 381 537 1.9e-45 PFAM
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adenylate kinase family, which is involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. This member is related to the UMP/CMP kinase of several species. It is located in the cytosol and expressed exclusively in brain. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,368,187 probably null Het
Acsm2 A G 7: 119,554,509 H14R unknown Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Alk G T 17: 71,899,241 S1038* probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Ap2m1 A T 16: 20,543,384 H414L possibly damaging Het
Atp13a5 A T 16: 29,282,024 M649K probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cdc25b A G 2: 131,191,698 S186G probably benign Het
Ceacam16 A G 7: 19,853,589 V418A possibly damaging Het
Cntnap3 A C 13: 64,778,853 S568A possibly damaging Het
Col24a1 G T 3: 145,314,383 V172F possibly damaging Het
E430018J23Rik T G 7: 127,393,002 Q87P possibly damaging Het
Eef2 CCC CCCC 10: 81,178,768 probably null Het
Esp36 T A 17: 38,418,956 T15S unknown Het
Fam126a A C 5: 23,979,581 C218G possibly damaging Het
Fam26f T A 10: 34,127,831 T27S probably damaging Het
Fat2 A T 11: 55,309,640 H869Q possibly damaging Het
Fat3 A G 9: 16,031,152 V1308A probably damaging Het
Gimap3 T C 6: 48,765,946 T17A possibly damaging Het
Hnrnpr A G 4: 136,317,148 K13R probably benign Het
Kdr A G 5: 75,943,925 M1133T possibly damaging Het
Mgarp A G 3: 51,396,260 probably benign Het
Neto2 G A 8: 85,641,083 T337I probably damaging Het
Nfib C T 4: 82,498,435 R137Q probably damaging Het
Nr3c2 A G 8: 77,217,467 E890G probably damaging Het
Nsun4 A G 4: 116,040,130 V228A possibly damaging Het
Nt5c1a T A 4: 123,215,896 S263T probably benign Het
Ntm A T 9: 29,012,220 Y45* probably null Het
Nts A G 10: 102,485,027 V67A probably benign Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Olfr378 A T 11: 73,425,711 S91T possibly damaging Het
Olfr384 A G 11: 73,602,886 Y102C probably damaging Het
Olfr610 T A 7: 103,506,139 K269M probably benign Het
Ostm1 C A 10: 42,679,123 A47E probably benign Het
Otol1 G A 3: 70,018,548 V19M probably benign Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcdhgb1 T C 18: 37,681,251 I265T probably damaging Het
Pdzd3 T C 9: 44,247,988 *499W probably null Het
Pex14 T C 4: 148,961,510 E321G possibly damaging Het
Phactr3 C A 2: 178,283,132 R251S probably damaging Het
Pkdcc C T 17: 83,221,141 T313M probably benign Het
Plce1 A T 19: 38,767,301 E1911V probably damaging Het
Ptprv G T 1: 135,114,570 noncoding transcript Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rhob A G 12: 8,499,533 Y34H possibly damaging Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc9c1 A T 16: 45,599,466 I1000F possibly damaging Het
Tcf7 G T 11: 52,261,615 P36T probably benign Het
Tcf7l1 C G 6: 72,788,769 E62Q probably damaging Het
Tctex1d4 C T 4: 117,128,123 R48C probably damaging Het
Tll2 A G 19: 41,121,348 S326P probably benign Het
Tubgcp4 A G 2: 121,184,473 N288S probably benign Het
Zfhx3 G A 8: 108,955,637 R3236H unknown Het
Zgrf1 A G 3: 127,562,078 T318A probably benign Het
Other mutations in Ak5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02178:Ak5 APN 3 152526785 missense probably benign 0.28
IGL02237:Ak5 APN 3 152499343 missense probably benign 0.44
IGL02661:Ak5 APN 3 152463956 missense probably benign
IGL03097:Ak5 UTSW 3 152660514 critical splice donor site probably null
R0645:Ak5 UTSW 3 152653615 missense probably damaging 1.00
R1135:Ak5 UTSW 3 152653662 missense probably damaging 1.00
R1346:Ak5 UTSW 3 152533434 missense probably damaging 1.00
R1347:Ak5 UTSW 3 152533434 missense probably damaging 1.00
R1347:Ak5 UTSW 3 152533434 missense probably damaging 1.00
R1349:Ak5 UTSW 3 152533434 missense probably damaging 1.00
R1749:Ak5 UTSW 3 152472920 missense probably damaging 0.99
R2059:Ak5 UTSW 3 152660637 missense probably damaging 1.00
R3929:Ak5 UTSW 3 152667807 missense probably damaging 0.98
R4909:Ak5 UTSW 3 152655877 missense probably damaging 1.00
R5052:Ak5 UTSW 3 152660567 missense probably benign 0.00
R5097:Ak5 UTSW 3 152481633 missense probably damaging 0.99
R5645:Ak5 UTSW 3 152656033 missense possibly damaging 0.92
R5907:Ak5 UTSW 3 152615952 missense probably damaging 1.00
R6505:Ak5 UTSW 3 152481669 missense probably benign 0.01
R7117:Ak5 UTSW 3 152615856 critical splice donor site probably null
R7397:Ak5 UTSW 3 152478352 missense probably damaging 1.00
X0023:Ak5 UTSW 3 152616027 missense probably damaging 1.00
X0024:Ak5 UTSW 3 152653597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTCTGTGGCTACTAGGG -3'
(R):5'- CTAACTGGTCAACTGTGAAGAAGTG -3'

Sequencing Primer
(F):5'- CTTGGAGATATTGTTTACAGGTCATC -3'
(R):5'- GAAGAAGTGCTTCCCTCTGC -3'
Posted On2015-07-21