Incidental Mutation 'R4434:Gnptab'
ID328755
Institutional Source Beutler Lab
Gene Symbol Gnptab
Ensembl Gene ENSMUSG00000035311
Gene NameN-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
SynonymsEG432486
MMRRC Submission 041148-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.897) question?
Stock #R4434 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location88379132-88447329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88412622 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 104 (N104S)
Ref Sequence ENSEMBL: ENSMUSP00000120643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000127615] [ENSMUST00000130301] [ENSMUST00000151273]
Predicted Effect probably damaging
Transcript: ENSMUST00000020251
AA Change: N114S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: N114S

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Stealth_CR1 73 101 6.6e-14 PFAM
Pfam:Stealth_CR2 322 429 8.8e-49 PFAM
NL 431 469 3.82e-7 SMART
low complexity region 480 490 N/A INTRINSIC
NL 498 536 2.37e-2 SMART
DMAP_binding 699 813 6.14e-38 SMART
Pfam:Stealth_CR3 934 982 2.9e-21 PFAM
Pfam:Stealth_CR4 1117 1173 7.9e-28 PFAM
transmembrane domain 1192 1214 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127615
AA Change: N98S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116915
Gene: ENSMUSG00000035311
AA Change: N98S

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
coiled coil region 71 98 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130301
AA Change: N104S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120643
Gene: ENSMUSG00000035311
AA Change: N104S

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
coiled coil region 77 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151273
SMART Domains Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A T 8: 111,054,621 Q907L probably null Het
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
AI597479 C T 1: 43,100,799 Q62* probably null Het
Akap9 T A 5: 4,032,708 M1944K probably damaging Het
Akr1c19 T C 13: 4,242,616 V212A probably benign Het
Ank3 C T 10: 69,987,070 S523L probably damaging Het
Antxrl G A 14: 34,071,617 probably benign Het
Arhgap21 A G 2: 20,967,335 C26R probably benign Het
Cdc37l1 T C 19: 29,007,621 F224L probably damaging Het
Csmd3 G A 15: 47,899,795 T1215I possibly damaging Het
Dnah7c G A 1: 46,666,282 R2485H probably damaging Het
Dnah9 T A 11: 66,108,075 N1049I possibly damaging Het
Dnaja3 T G 16: 4,689,995 Y120* probably null Het
Ehbp1l1 G T 19: 5,716,248 R412S possibly damaging Het
Fam169a A G 13: 97,126,740 D567G probably damaging Het
Fam208a G A 14: 27,449,861 probably null Het
Gcnt4 T A 13: 96,946,342 Y49N probably benign Het
Gm5849 T A 3: 90,777,875 K1M probably null Het
Gngt1 A G 6: 3,994,282 D20G probably benign Het
Gpn3 A G 5: 122,382,052 D223G probably benign Het
Hectd1 A T 12: 51,752,052 I2095K probably damaging Het
Hephl1 C T 9: 15,076,796 R672H probably damaging Het
Hpse2 A G 19: 43,294,269 S182P probably benign Het
Itgb4 T A 11: 115,999,814 S1109R probably benign Het
Itgbl1 A T 14: 123,972,199 D330V probably damaging Het
Krt77 A T 15: 101,865,469 V250E probably damaging Het
Mycbp2 T A 14: 103,133,789 N4108Y probably damaging Het
Nampt T C 12: 32,838,363 I171T probably damaging Het
Nckap5l A C 15: 99,422,863 S1270A probably benign Het
Olfr16 C T 1: 172,957,544 H250Y probably damaging Het
Opa1 A G 16: 29,611,983 I500M probably damaging Het
Pax8 G A 2: 24,429,609 P350L possibly damaging Het
Plxnb2 A G 15: 89,162,803 C772R probably damaging Het
Prh1 A T 6: 132,571,878 H116L unknown Het
Rgsl1 C T 1: 153,802,341 A114T possibly damaging Het
Rln1 A T 19: 29,334,562 F12Y possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Scube1 A T 15: 83,721,924 I49N probably damaging Het
Shank3 C A 15: 89,503,359 L244I probably damaging Het
Shc3 T C 13: 51,449,266 T268A probably benign Het
Sp7 A G 15: 102,359,101 L90P probably damaging Het
Tacc2 G A 7: 130,623,541 S652N probably damaging Het
Tacstd2 A G 6: 67,535,144 V188A possibly damaging Het
Tex26 T C 5: 149,453,355 S70P probably benign Het
Tmc4 C T 7: 3,672,007 V222M probably benign Het
Tnc T C 4: 64,007,829 T905A possibly damaging Het
Trim65 G A 11: 116,127,609 Q253* probably null Het
Tuba3a A T 6: 125,281,543 Y161* probably null Het
Zfand2b A G 1: 75,170,686 S197G possibly damaging Het
Zfp109 T A 7: 24,229,346 T213S probably benign Het
Zfp985 A C 4: 147,583,911 D412A probably benign Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Gnptab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Gnptab APN 10 88433065 missense probably damaging 0.99
IGL01346:Gnptab APN 10 88436179 missense possibly damaging 0.65
IGL01626:Gnptab APN 10 88437495 missense probably damaging 0.98
IGL01642:Gnptab APN 10 88436132 missense possibly damaging 0.89
IGL02121:Gnptab APN 10 88429461 missense possibly damaging 0.90
IGL03076:Gnptab APN 10 88440289 missense possibly damaging 0.91
IGL03130:Gnptab APN 10 88436371 missense possibly damaging 0.95
maze UTSW 10 88432573 missense probably damaging 1.00
R0103:Gnptab UTSW 10 88429519 missense probably damaging 1.00
R0103:Gnptab UTSW 10 88429519 missense probably damaging 1.00
R0114:Gnptab UTSW 10 88433400 missense possibly damaging 0.48
R0206:Gnptab UTSW 10 88439510 missense probably damaging 0.98
R0288:Gnptab UTSW 10 88433105 missense probably benign 0.00
R0329:Gnptab UTSW 10 88440309 missense probably damaging 1.00
R0330:Gnptab UTSW 10 88440309 missense probably damaging 1.00
R0369:Gnptab UTSW 10 88433594 missense possibly damaging 0.87
R0385:Gnptab UTSW 10 88436525 missense probably damaging 1.00
R0522:Gnptab UTSW 10 88431466 splice site probably benign
R0569:Gnptab UTSW 10 88428557 missense possibly damaging 0.89
R0671:Gnptab UTSW 10 88443304 splice site probably benign
R0834:Gnptab UTSW 10 88429952 missense probably damaging 1.00
R1375:Gnptab UTSW 10 88432573 missense probably damaging 1.00
R1443:Gnptab UTSW 10 88434081 missense probably damaging 1.00
R1464:Gnptab UTSW 10 88445754 splice site probably benign
R1471:Gnptab UTSW 10 88445763 missense probably benign
R1570:Gnptab UTSW 10 88419454 missense probably damaging 0.99
R1612:Gnptab UTSW 10 88428482 splice site probably null
R1614:Gnptab UTSW 10 88414589 missense probably benign
R1638:Gnptab UTSW 10 88436167 missense possibly damaging 0.94
R1739:Gnptab UTSW 10 88436095 missense probably benign 0.14
R1894:Gnptab UTSW 10 88419127 missense possibly damaging 0.69
R2092:Gnptab UTSW 10 88440305 nonsense probably null
R2118:Gnptab UTSW 10 88436398 missense probably benign 0.13
R2144:Gnptab UTSW 10 88428506 missense possibly damaging 0.89
R2174:Gnptab UTSW 10 88434044 missense probably damaging 1.00
R3847:Gnptab UTSW 10 88433577 nonsense probably null
R3943:Gnptab UTSW 10 88433894 missense probably benign
R4545:Gnptab UTSW 10 88414595 missense probably benign 0.00
R4776:Gnptab UTSW 10 88436528 missense probably damaging 1.00
R4786:Gnptab UTSW 10 88436182 missense probably damaging 1.00
R4880:Gnptab UTSW 10 88432551 nonsense probably null
R4889:Gnptab UTSW 10 88433913 missense probably benign 0.00
R4923:Gnptab UTSW 10 88429623 missense probably benign 0.17
R5694:Gnptab UTSW 10 88414486 missense probably benign 0.01
R5943:Gnptab UTSW 10 88433514 missense probably benign 0.00
R6027:Gnptab UTSW 10 88433225 missense probably damaging 0.98
R6074:Gnptab UTSW 10 88433078 missense probably damaging 1.00
R6119:Gnptab UTSW 10 88431395 missense probably damaging 1.00
R6182:Gnptab UTSW 10 88429480 missense possibly damaging 0.71
R6757:Gnptab UTSW 10 88437502 missense probably damaging 0.98
R6910:Gnptab UTSW 10 88431396 missense probably damaging 1.00
R6911:Gnptab UTSW 10 88431396 missense probably damaging 1.00
R7094:Gnptab UTSW 10 88379504 missense possibly damaging 0.66
R7101:Gnptab UTSW 10 88440312 missense probably benign 0.19
R7164:Gnptab UTSW 10 88434070 nonsense probably null
R7214:Gnptab UTSW 10 88379157
R7316:Gnptab UTSW 10 88400710 missense not run
X0064:Gnptab UTSW 10 88436530 missense probably damaging 1.00
X0066:Gnptab UTSW 10 88412011 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCCCGGTGCTAAGAGATG -3'
(R):5'- CAATTCTCTCTAACGAGTGCAC -3'

Sequencing Primer
(F):5'- TGCTAAGAGATGAGCACCTTATACG -3'
(R):5'- CTCTAACGAGTGCACTTCATGGG -3'
Posted On2015-07-21