Incidental Mutation 'R4434:Gcnt4'
ID328764
Institutional Source Beutler Lab
Gene Symbol Gcnt4
Ensembl Gene ENSMUSG00000091387
Gene Nameglucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)
SynonymsLOC218476, LOC238786, Gm73, C2GNT3
MMRRC Submission 041148-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4434 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location96924689-96950906 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 96946342 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 49 (Y49N)
Ref Sequence ENSEMBL: ENSMUSP00000130496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171324]
Predicted Effect probably benign
Transcript: ENSMUST00000171324
AA Change: Y49N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130496
Gene: ENSMUSG00000091387
AA Change: Y49N

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Pfam:Branch 134 403 1.1e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222094
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display neutrophilia, increased aggression towards males, reduced serum thyroxine levels, and altered O-glycan structures in the stomach, colon, and small intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A T 8: 111,054,621 Q907L probably null Het
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
AI597479 C T 1: 43,100,799 Q62* probably null Het
Akap9 T A 5: 4,032,708 M1944K probably damaging Het
Akr1c19 T C 13: 4,242,616 V212A probably benign Het
Ank3 C T 10: 69,987,070 S523L probably damaging Het
Antxrl G A 14: 34,071,617 probably benign Het
Arhgap21 A G 2: 20,967,335 C26R probably benign Het
Cdc37l1 T C 19: 29,007,621 F224L probably damaging Het
Csmd3 G A 15: 47,899,795 T1215I possibly damaging Het
Dnah7c G A 1: 46,666,282 R2485H probably damaging Het
Dnah9 T A 11: 66,108,075 N1049I possibly damaging Het
Dnaja3 T G 16: 4,689,995 Y120* probably null Het
Ehbp1l1 G T 19: 5,716,248 R412S possibly damaging Het
Fam169a A G 13: 97,126,740 D567G probably damaging Het
Fam208a G A 14: 27,449,861 probably null Het
Gm5849 T A 3: 90,777,875 K1M probably null Het
Gngt1 A G 6: 3,994,282 D20G probably benign Het
Gnptab A G 10: 88,412,622 N104S probably damaging Het
Gpn3 A G 5: 122,382,052 D223G probably benign Het
Hectd1 A T 12: 51,752,052 I2095K probably damaging Het
Hephl1 C T 9: 15,076,796 R672H probably damaging Het
Hpse2 A G 19: 43,294,269 S182P probably benign Het
Itgb4 T A 11: 115,999,814 S1109R probably benign Het
Itgbl1 A T 14: 123,972,199 D330V probably damaging Het
Krt77 A T 15: 101,865,469 V250E probably damaging Het
Mycbp2 T A 14: 103,133,789 N4108Y probably damaging Het
Nampt T C 12: 32,838,363 I171T probably damaging Het
Nckap5l A C 15: 99,422,863 S1270A probably benign Het
Olfr16 C T 1: 172,957,544 H250Y probably damaging Het
Opa1 A G 16: 29,611,983 I500M probably damaging Het
Pax8 G A 2: 24,429,609 P350L possibly damaging Het
Plxnb2 A G 15: 89,162,803 C772R probably damaging Het
Prh1 A T 6: 132,571,878 H116L unknown Het
Rgsl1 C T 1: 153,802,341 A114T possibly damaging Het
Rln1 A T 19: 29,334,562 F12Y possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Scube1 A T 15: 83,721,924 I49N probably damaging Het
Shank3 C A 15: 89,503,359 L244I probably damaging Het
Shc3 T C 13: 51,449,266 T268A probably benign Het
Sp7 A G 15: 102,359,101 L90P probably damaging Het
Tacc2 G A 7: 130,623,541 S652N probably damaging Het
Tacstd2 A G 6: 67,535,144 V188A possibly damaging Het
Tex26 T C 5: 149,453,355 S70P probably benign Het
Tmc4 C T 7: 3,672,007 V222M probably benign Het
Tnc T C 4: 64,007,829 T905A possibly damaging Het
Trim65 G A 11: 116,127,609 Q253* probably null Het
Tuba3a A T 6: 125,281,543 Y161* probably null Het
Zfand2b A G 1: 75,170,686 S197G possibly damaging Het
Zfp109 T A 7: 24,229,346 T213S probably benign Het
Zfp985 A C 4: 147,583,911 D412A probably benign Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Gcnt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Gcnt4 APN 13 96946556 missense probably damaging 1.00
IGL02677:Gcnt4 APN 13 96947233 missense probably benign
IGL02936:Gcnt4 APN 13 96946411 missense probably benign 0.00
R0332:Gcnt4 UTSW 13 96946510 missense probably benign 0.01
R0741:Gcnt4 UTSW 13 96946432 nonsense probably null
R0853:Gcnt4 UTSW 13 96946835 missense probably damaging 1.00
R2156:Gcnt4 UTSW 13 96946466 missense probably damaging 0.99
R3837:Gcnt4 UTSW 13 96947014 nonsense probably null
R3838:Gcnt4 UTSW 13 96947014 nonsense probably null
R3839:Gcnt4 UTSW 13 96947014 nonsense probably null
R4611:Gcnt4 UTSW 13 96946482 missense probably benign
R4782:Gcnt4 UTSW 13 96947406 missense possibly damaging 0.88
R5853:Gcnt4 UTSW 13 96946652 missense probably benign 0.01
R6013:Gcnt4 UTSW 13 96947278 missense possibly damaging 0.95
R6139:Gcnt4 UTSW 13 96946852 missense probably benign 0.16
R6329:Gcnt4 UTSW 13 96947273 missense probably damaging 1.00
R7131:Gcnt4 UTSW 13 96946519 missense probably damaging 0.98
R7217:Gcnt4 UTSW 13 96946310 missense probably damaging 0.98
R7497:Gcnt4 UTSW 13 96946960 missense not run
R7509:Gcnt4 UTSW 13 96947170 missense not run
Predicted Primers PCR Primer
(F):5'- AGGTGGTACCCAGTAAACTTGG -3'
(R):5'- TGTCATCGCCACGACATCAC -3'

Sequencing Primer
(F):5'- CCCAGTAAACTTGGGATAAACTG -3'
(R):5'- ACCGTCCTCCAAGTCGATGATG -3'
Posted On2015-07-21