Incidental Mutation 'R4434:Itgbl1'
ID328769
Institutional Source Beutler Lab
Gene Symbol Itgbl1
Ensembl Gene ENSMUSG00000032925
Gene Nameintegrin, beta-like 1
SynonymsB930011D01Rik, with EGF-like repeat domains
MMRRC Submission 041148-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R4434 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location123659971-123975618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123972199 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 330 (D330V)
Ref Sequence ENSEMBL: ENSMUSP00000115455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049681] [ENSMUST00000132026] [ENSMUST00000142161]
Predicted Effect probably damaging
Transcript: ENSMUST00000049681
AA Change: D454V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059019
Gene: ENSMUSG00000032925
AA Change: D454V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
internal_repeat_1 62 164 7.9e-12 PROSPERO
EGF_like 184 217 6.95e1 SMART
EGF 275 311 2.25e1 SMART
low complexity region 335 348 N/A INTRINSIC
Pfam:EGF_2 368 398 3.6e-8 PFAM
low complexity region 423 438 N/A INTRINSIC
low complexity region 448 456 N/A INTRINSIC
Blast:EGF_like 457 486 4e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000132026
AA Change: D330V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115455
Gene: ENSMUSG00000032925
AA Change: D330V

DomainStartEndE-ValueType
internal_repeat_2 22 50 3.54e-8 PROSPERO
internal_repeat_1 23 87 7.45e-14 PROSPERO
low complexity region 101 126 N/A INTRINSIC
EGF 151 187 2.25e1 SMART
low complexity region 211 224 N/A INTRINSIC
Pfam:EGF_2 239 274 1.5e-7 PFAM
low complexity region 299 314 N/A INTRINSIC
low complexity region 324 332 N/A INTRINSIC
internal_repeat_2 334 362 3.54e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000142161
SMART Domains Protein: ENSMUSP00000121659
Gene: ENSMUSG00000032925

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
PDB:4G1E|B 59 171 1e-17 PDB
Blast:EGF_like 90 127 5e-15 BLAST
low complexity region 178 192 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a beta integrin-related protein that is a member of the EGF-like protein family. The encoded protein contains integrin-like cysteine-rich repeats. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A T 8: 111,054,621 Q907L probably null Het
Adam6b A C 12: 113,490,661 Q366P probably damaging Het
AI597479 C T 1: 43,100,799 Q62* probably null Het
Akap9 T A 5: 4,032,708 M1944K probably damaging Het
Akr1c19 T C 13: 4,242,616 V212A probably benign Het
Ank3 C T 10: 69,987,070 S523L probably damaging Het
Antxrl G A 14: 34,071,617 probably benign Het
Arhgap21 A G 2: 20,967,335 C26R probably benign Het
Cdc37l1 T C 19: 29,007,621 F224L probably damaging Het
Csmd3 G A 15: 47,899,795 T1215I possibly damaging Het
Dnah7c G A 1: 46,666,282 R2485H probably damaging Het
Dnah9 T A 11: 66,108,075 N1049I possibly damaging Het
Dnaja3 T G 16: 4,689,995 Y120* probably null Het
Ehbp1l1 G T 19: 5,716,248 R412S possibly damaging Het
Fam169a A G 13: 97,126,740 D567G probably damaging Het
Fam208a G A 14: 27,449,861 probably null Het
Gcnt4 T A 13: 96,946,342 Y49N probably benign Het
Gm5849 T A 3: 90,777,875 K1M probably null Het
Gngt1 A G 6: 3,994,282 D20G probably benign Het
Gnptab A G 10: 88,412,622 N104S probably damaging Het
Gpn3 A G 5: 122,382,052 D223G probably benign Het
Hectd1 A T 12: 51,752,052 I2095K probably damaging Het
Hephl1 C T 9: 15,076,796 R672H probably damaging Het
Hpse2 A G 19: 43,294,269 S182P probably benign Het
Itgb4 T A 11: 115,999,814 S1109R probably benign Het
Krt77 A T 15: 101,865,469 V250E probably damaging Het
Mycbp2 T A 14: 103,133,789 N4108Y probably damaging Het
Nampt T C 12: 32,838,363 I171T probably damaging Het
Nckap5l A C 15: 99,422,863 S1270A probably benign Het
Olfr16 C T 1: 172,957,544 H250Y probably damaging Het
Opa1 A G 16: 29,611,983 I500M probably damaging Het
Pax8 G A 2: 24,429,609 P350L possibly damaging Het
Plxnb2 A G 15: 89,162,803 C772R probably damaging Het
Prh1 A T 6: 132,571,878 H116L unknown Het
Rgsl1 C T 1: 153,802,341 A114T possibly damaging Het
Rln1 A T 19: 29,334,562 F12Y possibly damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Scube1 A T 15: 83,721,924 I49N probably damaging Het
Shank3 C A 15: 89,503,359 L244I probably damaging Het
Shc3 T C 13: 51,449,266 T268A probably benign Het
Sp7 A G 15: 102,359,101 L90P probably damaging Het
Tacc2 G A 7: 130,623,541 S652N probably damaging Het
Tacstd2 A G 6: 67,535,144 V188A possibly damaging Het
Tex26 T C 5: 149,453,355 S70P probably benign Het
Tmc4 C T 7: 3,672,007 V222M probably benign Het
Tnc T C 4: 64,007,829 T905A possibly damaging Het
Trim65 G A 11: 116,127,609 Q253* probably null Het
Tuba3a A T 6: 125,281,543 Y161* probably null Het
Zfand2b A G 1: 75,170,686 S197G possibly damaging Het
Zfp109 T A 7: 24,229,346 T213S probably benign Het
Zfp985 A C 4: 147,583,911 D412A probably benign Het
Zswim3 T A 2: 164,820,643 C348S probably benign Het
Other mutations in Itgbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Itgbl1 APN 14 123846432 splice site probably benign
IGL01290:Itgbl1 APN 14 123966725 missense probably benign 0.02
IGL01618:Itgbl1 APN 14 123827799 missense possibly damaging 0.88
IGL02024:Itgbl1 APN 14 123857492 missense probably damaging 1.00
IGL02192:Itgbl1 APN 14 123843926 missense probably damaging 1.00
IGL02215:Itgbl1 APN 14 123972141 missense probably benign 0.01
IGL02400:Itgbl1 APN 14 123846526 missense probably damaging 1.00
IGL02483:Itgbl1 APN 14 123827743 splice site probably benign
H8441:Itgbl1 UTSW 14 123973287 missense probably damaging 1.00
R0137:Itgbl1 UTSW 14 123840686 critical splice donor site probably null
R0193:Itgbl1 UTSW 14 123846546 missense probably benign 0.09
R0355:Itgbl1 UTSW 14 123840585 nonsense probably null
R0598:Itgbl1 UTSW 14 123857436 missense possibly damaging 0.93
R0662:Itgbl1 UTSW 14 123827894 missense probably damaging 1.00
R0689:Itgbl1 UTSW 14 123827847 missense possibly damaging 0.65
R1385:Itgbl1 UTSW 14 123661511 splice site probably null
R1957:Itgbl1 UTSW 14 123966678 missense probably damaging 1.00
R3739:Itgbl1 UTSW 14 123966678 missense probably damaging 1.00
R3842:Itgbl1 UTSW 14 123840565 missense possibly damaging 0.92
R4463:Itgbl1 UTSW 14 123840668 missense probably damaging 0.97
R4696:Itgbl1 UTSW 14 123966708 missense probably damaging 1.00
R4937:Itgbl1 UTSW 14 123973368 missense probably benign 0.12
R5087:Itgbl1 UTSW 14 123966739 missense possibly damaging 0.52
R5747:Itgbl1 UTSW 14 123972164 nonsense probably null
R6020:Itgbl1 UTSW 14 123846565 missense probably damaging 0.99
R6169:Itgbl1 UTSW 14 123660378 missense probably benign 0.17
R6758:Itgbl1 UTSW 14 123857489 missense probably benign 0.23
V1024:Itgbl1 UTSW 14 123973287 missense probably damaging 1.00
X0012:Itgbl1 UTSW 14 123661305 missense probably benign 0.01
X0017:Itgbl1 UTSW 14 123972211 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CCCTCTGAGAAGCAGCTATTC -3'
(R):5'- GAGTTACTACACATGGGCATTGTTC -3'

Sequencing Primer
(F):5'- CTCTGAGAAGCAGCTATTCAATAAAC -3'
(R):5'- CTACACATGGGCATTGTTCATTTGAG -3'
Posted On2015-07-21