Incidental Mutation 'R0044:Tmtc1'
ID32879
Institutional Source Beutler Lab
Gene Symbol Tmtc1
Ensembl Gene ENSMUSG00000030306
Gene Nametransmembrane and tetratricopeptide repeat containing 1
Synonyms
MMRRC Submission 038338-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R0044 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location148232430-148444389 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 148412829 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060095] [ENSMUST00000100772] [ENSMUST00000140797] [ENSMUST00000203991]
Predicted Effect probably benign
Transcript: ENSMUST00000060095
SMART Domains Protein: ENSMUSP00000056353
Gene: ENSMUSG00000030306

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 111 130 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
low complexity region 170 180 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
low complexity region 250 269 N/A INTRINSIC
transmembrane domain 328 350 N/A INTRINSIC
Pfam:DUF1736 351 425 1.3e-33 PFAM
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 494 516 N/A INTRINSIC
TPR 543 576 2.42e-3 SMART
TPR 577 607 8.76e-1 SMART
TPR 608 641 1.69e-2 SMART
TPR 642 675 1.28e-2 SMART
TPR 676 709 4.31e0 SMART
TPR 710 743 1.11e-2 SMART
TPR 744 776 4.62e0 SMART
TPR 811 844 1.1e-1 SMART
TPR 849 882 4.45e-2 SMART
TPR 883 916 1.05e-3 SMART
low complexity region 926 941 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100772
SMART Domains Protein: ENSMUSP00000098335
Gene: ENSMUSG00000030306

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 111 130 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
low complexity region 170 180 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
low complexity region 250 269 N/A INTRINSIC
Pfam:DUF1736 349 427 6.9e-35 PFAM
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 494 516 N/A INTRINSIC
TPR 539 569 8.76e-1 SMART
TPR 570 603 1.69e-2 SMART
TPR 604 637 1.28e-2 SMART
TPR 638 671 4.31e0 SMART
TPR 672 705 1.11e-2 SMART
TPR 706 738 4.62e0 SMART
TPR 773 806 1.1e-1 SMART
TPR 811 844 4.45e-2 SMART
TPR 845 878 1.05e-3 SMART
low complexity region 888 903 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140797
SMART Domains Protein: ENSMUSP00000115543
Gene: ENSMUSG00000030306

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
transmembrane domain 112 134 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
Pfam:DUF1736 259 337 9.9e-36 PFAM
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 403 425 N/A INTRINSIC
Pfam:TPR_12 449 516 9.6e-10 PFAM
Pfam:TPR_11 451 498 1.3e-9 PFAM
Pfam:TPR_1 453 486 5.7e-6 PFAM
Pfam:TPR_2 453 486 2.6e-7 PFAM
Pfam:TPR_8 453 486 6.5e-4 PFAM
Pfam:TPR_1 487 517 1.6e-3 PFAM
Pfam:TPR_8 496 518 1.5e-3 PFAM
low complexity region 521 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203991
SMART Domains Protein: ENSMUSP00000144991
Gene: ENSMUSG00000030306

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
transmembrane domain 112 134 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430571L13Rik A C 9: 107,342,499 R50S probably damaging Het
Actn2 G T 13: 12,275,127 T176N possibly damaging Het
Adamts7 T C 9: 90,171,588 V62A possibly damaging Het
Adcy2 A G 13: 68,727,899 S495P possibly damaging Het
Agbl3 A T 6: 34,799,899 M447L probably damaging Het
Asxl1 C T 2: 153,400,209 T893I probably benign Het
Atp11b T A 3: 35,812,252 I400N probably damaging Het
Bpifb2 C T 2: 153,882,679 probably benign Het
Capn1 T A 19: 6,014,343 Y42F probably benign Het
Cdk5rap2 A T 4: 70,360,901 L190H probably damaging Het
Cfap54 T C 10: 93,035,433 I594V probably null Het
Cpsf1 A G 15: 76,599,553 V830A probably benign Het
Cyp2c70 T A 19: 40,165,371 N258I possibly damaging Het
Dctn1 T G 6: 83,191,134 Y386D probably damaging Het
Degs2 T C 12: 108,692,154 N189D probably damaging Het
Dido1 C T 2: 180,661,819 A1431T probably damaging Het
Diras1 G T 10: 81,022,138 S93* probably null Het
E130308A19Rik T A 4: 59,690,290 H41Q possibly damaging Het
Ebf2 C T 14: 67,310,968 probably benign Het
Fcho2 A G 13: 98,755,544 probably benign Het
Gbe1 T A 16: 70,561,132 Y681* probably null Het
Gm10036 A C 18: 15,832,816 K8T probably benign Het
Herc1 T A 9: 66,448,175 M2236K probably benign Het
Hmcn2 A T 2: 31,412,508 Y2948F probably damaging Het
Jakmip2 A T 18: 43,582,105 C119S probably benign Het
Kif1b A G 4: 149,263,601 probably benign Het
Kif6 T C 17: 49,832,256 probably benign Het
Lpin1 A T 12: 16,568,529 probably benign Het
Lrp2 T C 2: 69,527,555 I377V probably benign Het
Mavs C A 2: 131,242,024 T147N probably damaging Het
Mcoln2 C T 3: 146,183,561 T374M probably damaging Het
Mreg T G 1: 72,162,375 T153P probably damaging Het
Naglu T C 11: 101,071,217 I172T probably damaging Het
Ogdhl T C 14: 32,339,328 V492A possibly damaging Het
Olfr1245 A G 2: 89,575,630 I32T possibly damaging Het
Parvg A G 15: 84,337,882 E323G probably benign Het
Pgap1 A G 1: 54,493,368 L664S probably damaging Het
Pgm2l1 A G 7: 100,250,332 N51S probably benign Het
Pik3r6 A G 11: 68,544,750 T609A probably benign Het
Plcb4 T A 2: 135,971,856 V705E probably damaging Het
Plppr5 T A 3: 117,671,889 probably null Het
Prkg2 C A 5: 98,973,130 D411Y probably damaging Het
Ptprd A G 4: 76,086,329 V63A probably benign Het
Ptprz1 T A 6: 23,007,403 I1655N probably damaging Het
Raf1 T A 6: 115,623,515 D10V probably benign Het
Rexo1 T A 10: 80,544,378 Q928L probably benign Het
Rpl7l1 A C 17: 46,778,530 probably null Het
Rrm2b A G 15: 37,953,688 S39P possibly damaging Het
Scn5a A G 9: 119,492,047 probably null Het
Sgtb A G 13: 104,129,260 T93A probably benign Het
Sigirr G T 7: 141,092,313 probably null Het
Slc16a7 T C 10: 125,228,082 D462G probably benign Het
Slc25a30 C T 14: 75,769,649 A85T probably benign Het
Spata24 A G 18: 35,656,834 S167P probably damaging Het
Spock3 C T 8: 63,144,007 T115I possibly damaging Het
Srgap2 A G 1: 131,319,551 I581T possibly damaging Het
Syn2 A T 6: 115,135,147 M23L unknown Het
Synrg G A 11: 84,009,181 V839I probably damaging Het
Tnfaip3 C A 10: 19,011,626 M50I probably damaging Het
Topbp1 T A 9: 103,325,773 I721N possibly damaging Het
Ttc22 T G 4: 106,636,806 V321G probably benign Het
Ttc25 A T 11: 100,567,001 I477F probably damaging Het
Ubr2 A G 17: 46,992,985 probably benign Het
Ubr4 T C 4: 139,437,058 probably benign Het
Usp24 T C 4: 106,412,084 probably benign Het
Vmn2r100 A T 17: 19,522,179 I272L possibly damaging Het
Vrtn T A 12: 84,648,605 L43H probably damaging Het
Wnk1 G T 6: 120,037,149 R162S probably damaging Het
Xkr9 G A 1: 13,684,062 W93* probably null Het
Zfp804b G T 5: 6,769,655 P1136H probably damaging Het
Other mutations in Tmtc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Tmtc1 APN 6 148443944 missense probably benign 0.02
IGL01377:Tmtc1 APN 6 148245787 missense possibly damaging 0.82
IGL01728:Tmtc1 APN 6 148411066 missense probably benign 0.02
IGL02904:Tmtc1 APN 6 148249482 splice site probably benign
R0107:Tmtc1 UTSW 6 148425913 missense possibly damaging 0.85
R0114:Tmtc1 UTSW 6 148412830 splice site probably benign
R0243:Tmtc1 UTSW 6 148246837 missense probably damaging 1.00
R0310:Tmtc1 UTSW 6 148249581 missense probably benign 0.00
R0441:Tmtc1 UTSW 6 148415758 missense probably damaging 1.00
R0491:Tmtc1 UTSW 6 148412640 critical splice donor site probably null
R0578:Tmtc1 UTSW 6 148355218 intron probably benign
R0685:Tmtc1 UTSW 6 148411240 missense probably benign 0.39
R1470:Tmtc1 UTSW 6 148305985 splice site probably benign
R1533:Tmtc1 UTSW 6 148245710 critical splice donor site probably null
R1577:Tmtc1 UTSW 6 148412820 critical splice acceptor site probably null
R1617:Tmtc1 UTSW 6 148355404 intron probably benign
R1763:Tmtc1 UTSW 6 148294618 missense probably damaging 1.00
R1909:Tmtc1 UTSW 6 148444048 missense possibly damaging 0.93
R1943:Tmtc1 UTSW 6 148425918 nonsense probably null
R2050:Tmtc1 UTSW 6 148262883 missense probably damaging 1.00
R2305:Tmtc1 UTSW 6 148244697 missense probably damaging 0.99
R3813:Tmtc1 UTSW 6 148354891 intron probably benign
R4355:Tmtc1 UTSW 6 148355098 intron probably benign
R4537:Tmtc1 UTSW 6 148262782 critical splice donor site probably null
R4731:Tmtc1 UTSW 6 148284980 splice site probably null
R4732:Tmtc1 UTSW 6 148284980 splice site probably null
R4733:Tmtc1 UTSW 6 148284980 splice site probably null
R4960:Tmtc1 UTSW 6 148443947 unclassified probably benign
R5048:Tmtc1 UTSW 6 148237846 missense possibly damaging 0.96
R5118:Tmtc1 UTSW 6 148269987 intron probably benign
R5279:Tmtc1 UTSW 6 148355131 intron probably benign
R5310:Tmtc1 UTSW 6 148355412 intron probably benign
R5411:Tmtc1 UTSW 6 148443899 critical splice donor site probably null
R5646:Tmtc1 UTSW 6 148246831 missense probably damaging 1.00
R5868:Tmtc1 UTSW 6 148237855 missense probably damaging 1.00
R6482:Tmtc1 UTSW 6 148412745 missense probably benign 0.00
R7162:Tmtc1 UTSW 6 148271487 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGGAAATGACTTACAACTTGTCCTGC -3'
(R):5'- TTGTACCAAGAAATCCGGCTTCCC -3'

Sequencing Primer
(F):5'- ACAACTTGTCCTGCTTGTGG -3'
(R):5'- actaaaccccttccttcagc -3'
Posted On2013-05-09