Incidental Mutation 'R4448:Fut7'
ID328819
Institutional Source Beutler Lab
Gene Symbol Fut7
Ensembl Gene ENSMUSG00000036587
Gene Namefucosyltransferase 7
SynonymsFTVII, FucT-VII, Fuc-TVII
MMRRC Submission 041709-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R4448 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25423267-25426374 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25424939 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 70 (T70A)
Ref Sequence ENSEMBL: ENSMUSP00000097895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041654] [ENSMUST00000100320] [ENSMUST00000102919] [ENSMUST00000114278] [ENSMUST00000134259]
Predicted Effect probably benign
Transcript: ENSMUST00000041654
AA Change: T23A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000039985
Gene: ENSMUSG00000036587
AA Change: T23A

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 10 341 5.1e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100320
AA Change: T70A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097895
Gene: ENSMUSG00000036587
AA Change: T70A

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
Pfam:Glyco_tran_10_N 91 201 8.8e-37 PFAM
Pfam:Glyco_transf_10 216 387 6.5e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102919
SMART Domains Protein: ENSMUSP00000099983
Gene: ENSMUSG00000026944

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
coiled coil region 271 296 N/A INTRINSIC
low complexity region 309 346 N/A INTRINSIC
Pfam:ABC2_membrane_3 493 911 9.7e-18 PFAM
AAA 1015 1197 9.22e-7 SMART
low complexity region 1364 1376 N/A INTRINSIC
low complexity region 1589 1607 N/A INTRINSIC
Pfam:ABC2_membrane_3 1696 2008 2.3e-44 PFAM
AAA 2079 2264 1.12e-5 SMART
low complexity region 2375 2394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114278
AA Change: T23A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000109917
Gene: ENSMUSG00000036587
AA Change: T23A

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 10 341 5.1e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134259
AA Change: T23A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000123526
Gene: ENSMUSG00000036587
AA Change: T23A

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 9 104 2.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142156
Meta Mutation Damage Score 0.1316 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 94% (49/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Golgi stack membrane protein that is involved in the creation of sialyl-Lewis X antigens. The encoded protein can direct the synthesis of the E-selectin-binding sialyl-Lewis X moiety. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are superficially normal. However, abnormalities are found in immune cell function and lymph node morphology. Redeuced tumor metastasis is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
A1cf A T 19: 31,945,862 T513S probably benign Het
Acaca A T 11: 84,262,492 I909F probably damaging Het
Adgb T C 10: 10,390,825 I980V probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Asb8 A G 15: 98,141,330 V63A possibly damaging Het
Atp6v1b2 T A 8: 69,102,022 D126E probably benign Het
BC048562 T A 9: 108,438,524 L43Q probably damaging Het
Ctcf A T 8: 105,680,293 probably benign Het
Efs A G 14: 54,920,192 S128P probably damaging Het
Epg5 T A 18: 77,962,461 M722K probably damaging Het
Ezr T C 17: 6,753,074 I203V probably benign Het
F5 A T 1: 164,198,899 N1680I possibly damaging Het
Fcna A G 2: 25,625,476 F194L probably damaging Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm13128 A C 4: 144,332,685 H322P probably damaging Het
Gpr4 G A 7: 19,223,001 A283T probably damaging Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hhip C T 8: 80,043,945 probably null Het
Hoxc12 A G 15: 102,938,476 K268E probably damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Kansl1l A G 1: 66,738,159 S605P probably damaging Het
Kcnh4 A G 11: 100,755,907 F198L probably benign Het
Kmt2e T C 5: 23,464,790 F92L possibly damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mycbp2 T C 14: 103,188,502 I2396V possibly damaging Het
Nckap5 G A 1: 126,025,726 Q1030* probably null Het
Pag1 T C 3: 9,699,466 E209G probably benign Het
Pttg1 A T 11: 43,424,690 probably benign Het
Rab38 T G 7: 88,490,625 D167E probably benign Het
Rbm26 A T 14: 105,151,550 F302I probably damaging Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sec23b A G 2: 144,559,251 N11D probably benign Het
Sipa1l1 G A 12: 82,341,750 G250D probably benign Het
Sipa1l2 A T 8: 125,492,355 V81D probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Sqstm1 A G 11: 50,203,039 probably benign Het
Taf4 A G 2: 179,935,971 L519P possibly damaging Het
Tdrd6 C T 17: 43,629,735 G141S probably benign Het
Urb1 C T 16: 90,769,394 V1502I possibly damaging Het
Vmn1r222 A C 13: 23,232,293 V250G probably benign Het
Vmn1r222 G A 13: 23,232,660 L128F probably damaging Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Fut7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Fut7 APN 2 25425331 nonsense probably null
IGL02483:Fut7 APN 2 25423876 missense possibly damaging 0.47
IGL02967:Fut7 APN 2 25425143 missense probably damaging 1.00
IGL03180:Fut7 APN 2 25425453 missense possibly damaging 0.79
R1524:Fut7 UTSW 2 25425147 missense probably damaging 1.00
R1968:Fut7 UTSW 2 25425726 missense probably benign 0.16
R2115:Fut7 UTSW 2 25425331 nonsense probably null
R2900:Fut7 UTSW 2 25423911 missense probably benign
R7019:Fut7 UTSW 2 25425780 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAAGGCTCCAGATGAATTGTATTG -3'
(R):5'- TGGAAGACCACAGCATCAGC -3'

Sequencing Primer
(F):5'- CCAGATGAATTGTATTGGTGAGTGCC -3'
(R):5'- CTCCGGTTAGCACTCAGAC -3'
Posted On2015-07-21