Mutagenetix > Incidental Mutation

Incidental Mutation 'R4449:Ubr1'

328864

Institutional Source

Beutler Lab

Gene Symbol

Ubr1

Ensembl Gene

ENSMUSG00000027272

Gene Name

ubiquitin protein ligase E3 component n-recognin 1

Synonyms

E3 alpha

MMRRC Submission

041710-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.826) question?

Stock #

R4449 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120690750-120801196 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 120776862 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 293 (V293A)

Ref Sequence

ENSEMBL: ENSMUSP00000028728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028728]

AlphaFold

O70481

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028728
AA Change: V293A

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: V293A

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	1.24e-35	SMART
Pfam:ClpS	221	301	8e-24	PFAM
low complexity region	918	936	N/A	INTRINSIC
low complexity region	1017	1030	N/A	INTRINSIC
low complexity region	1070	1081	N/A	INTRINSIC
Blast:RING	1101	1203	4e-34	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133408

Meta Mutation Damage Score

0.0641

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.9%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arfgap3	A	T	15: 83,218,759 (GRCm39)	Y105N	probably damaging	Het
Arid3b	T	A	9: 57,705,404 (GRCm39)	K266*	probably null	Het
Bend3	A	G	10: 43,388,079 (GRCm39)	E824G	possibly damaging	Het
Bpifb6	A	G	2: 153,748,688 (GRCm39)	E228G	possibly damaging	Het
Cadm1	T	A	9: 47,725,286 (GRCm39)		probably benign	Het
Cadm1	C	T	9: 47,441,735 (GRCm39)	A22V	possibly damaging	Het
Cntrob	C	A	11: 69,196,375 (GRCm39)	D687Y	probably benign	Het
Dap3	A	T	3: 88,857,185 (GRCm39)		probably benign	Het
Ddc	T	C	11: 11,785,802 (GRCm39)	D295G	probably damaging	Het
Fut10	T	A	8: 31,726,285 (GRCm39)	Y347N	probably damaging	Het
Galnt2	A	G	8: 125,022,116 (GRCm39)	D14G	probably benign	Het
Gm10722	A	C	9: 3,001,041 (GRCm39)	Y39S	probably benign	Het
Helz	T	C	11: 107,494,989 (GRCm39)	V321A	probably benign	Het
Hnrnpul1	T	C	7: 25,421,709 (GRCm39)		probably benign	Het
Hsdl2	T	A	4: 59,617,692 (GRCm39)	I353K	possibly damaging	Het
Igkv3-2	G	A	6: 70,675,825 (GRCm39)	A45T	probably benign	Het
Kcnh6	A	G	11: 105,909,762 (GRCm39)	Y429C	probably damaging	Het
Luzp1	T	A	4: 136,268,174 (GRCm39)	N132K	probably damaging	Het
Mlycd	T	A	8: 120,137,144 (GRCm39)	Y455N	probably damaging	Het
Myl7	C	T	11: 5,847,354 (GRCm39)	D115N	probably damaging	Het
Or52s1	A	T	7: 102,861,687 (GRCm39)	I196F	probably benign	Het
Pcdh7	A	G	5: 57,877,827 (GRCm39)	T461A	probably damaging	Het
Pi4kb	C	T	3: 94,892,046 (GRCm39)	S254L	probably benign	Het
Pitpnc1	A	G	11: 107,107,535 (GRCm39)	V257A	probably benign	Het
Prpf40b	A	G	15: 99,212,544 (GRCm39)	D596G	probably damaging	Het
Rngtt	T	C	4: 33,330,865 (GRCm39)	F156S	probably damaging	Het
Sema3c	A	G	5: 17,781,844 (GRCm39)		probably benign	Het
Shisa6	T	C	11: 66,416,244 (GRCm39)	T183A	probably benign	Het
Skint3	T	A	4: 112,127,206 (GRCm39)	V287E	possibly damaging	Het
Slc15a4	A	G	5: 127,681,600 (GRCm39)		probably null	Het
Slc17a3	A	T	13: 24,040,715 (GRCm39)	S392C	probably damaging	Het
Snx14	T	C	9: 88,305,052 (GRCm39)	I81V	probably benign	Het
Tdrd6	C	T	17: 43,940,626 (GRCm39)	G141S	probably benign	Het
Trappc12	A	T	12: 28,797,234 (GRCm39)	D99E	probably benign	Het
Trim34b	T	C	7: 103,984,935 (GRCm39)	C318R	probably benign	Het
Ttc39a	T	C	4: 109,299,500 (GRCm39)	I449T	possibly damaging	Het
Twsg1	A	C	17: 66,233,305 (GRCm39)	V215G	possibly damaging	Het
Ubqlnl	C	T	7: 103,798,925 (GRCm39)	V191M	probably benign	Het
Unk	G	A	11: 115,944,460 (GRCm39)	G404S	probably damaging	Het
Virma	T	C	4: 11,498,828 (GRCm39)		probably null	Het
Vps13b	T	C	15: 35,876,939 (GRCm39)	V2864A	possibly damaging	Het
Wdfy4	T	A	14: 32,818,040 (GRCm39)	R1492W	probably damaging	Het
Zcchc3	G	C	2: 152,256,642 (GRCm39)	P19R	probably benign	Het

Other mutations in Ubr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Ubr1	APN	2	120,705,888 (GRCm39)	missense	possibly damaging	0.65
IGL00570:Ubr1	APN	2	120,771,574 (GRCm39)	missense	possibly damaging	0.93
IGL00990:Ubr1	APN	2	120,761,353 (GRCm39)	missense	probably damaging	1.00
IGL01124:Ubr1	APN	2	120,745,386 (GRCm39)	missense	probably benign
IGL01346:Ubr1	APN	2	120,703,603 (GRCm39)	critical splice donor site	probably null
IGL01368:Ubr1	APN	2	120,771,612 (GRCm39)	splice site	probably benign
IGL01539:Ubr1	APN	2	120,756,494 (GRCm39)	missense	possibly damaging	0.79
IGL01862:Ubr1	APN	2	120,764,823 (GRCm39)	missense	possibly damaging	0.81
IGL01965:Ubr1	APN	2	120,705,879 (GRCm39)	missense	probably damaging	0.99
IGL01984:Ubr1	APN	2	120,751,867 (GRCm39)	missense	probably damaging	0.99
IGL02184:Ubr1	APN	2	120,730,989 (GRCm39)	missense	probably benign	0.00
IGL02208:Ubr1	APN	2	120,776,830 (GRCm39)	missense	probably benign	0.00
IGL02415:Ubr1	APN	2	120,801,084 (GRCm39)	utr 5 prime	probably benign
IGL02517:Ubr1	APN	2	120,694,854 (GRCm39)	missense	possibly damaging	0.69
IGL02614:Ubr1	APN	2	120,701,460 (GRCm39)	splice site	probably benign
IGL02627:Ubr1	APN	2	120,771,472 (GRCm39)	missense	probably damaging	1.00
IGL02718:Ubr1	APN	2	120,745,364 (GRCm39)	missense	probably damaging	1.00
IGL02741:Ubr1	APN	2	120,771,572 (GRCm39)	missense	probably benign	0.01
IGL02939:Ubr1	APN	2	120,711,664 (GRCm39)	critical splice acceptor site	probably null
IGL03081:Ubr1	APN	2	120,791,637 (GRCm39)	missense	possibly damaging	0.83
IGL03310:Ubr1	APN	2	120,694,898 (GRCm39)	missense	probably damaging	1.00
IGL03370:Ubr1	APN	2	120,725,641 (GRCm39)	missense	probably benign
I1329:Ubr1	UTSW	2	120,764,775 (GRCm39)	splice site	probably benign
R0022:Ubr1	UTSW	2	120,791,654 (GRCm39)	splice site	probably benign
R0345:Ubr1	UTSW	2	120,734,584 (GRCm39)	splice site	probably null
R0373:Ubr1	UTSW	2	120,777,138 (GRCm39)	missense	probably benign	0.01
R0393:Ubr1	UTSW	2	120,737,427 (GRCm39)	missense	probably damaging	1.00
R0543:Ubr1	UTSW	2	120,711,574 (GRCm39)	missense	probably damaging	1.00
R0559:Ubr1	UTSW	2	120,778,364 (GRCm39)	nonsense	probably null
R0723:Ubr1	UTSW	2	120,711,582 (GRCm39)	nonsense	probably null
R1178:Ubr1	UTSW	2	120,756,510 (GRCm39)	nonsense	probably null
R1401:Ubr1	UTSW	2	120,786,125 (GRCm39)	missense	probably benign	0.01
R1485:Ubr1	UTSW	2	120,791,579 (GRCm39)	missense	probably benign	0.03
R1572:Ubr1	UTSW	2	120,765,800 (GRCm39)	splice site	probably benign
R1920:Ubr1	UTSW	2	120,761,449 (GRCm39)	missense	probably benign	0.11
R1921:Ubr1	UTSW	2	120,761,449 (GRCm39)	missense	probably benign	0.11
R1997:Ubr1	UTSW	2	120,776,754 (GRCm39)	critical splice donor site	probably null
R2129:Ubr1	UTSW	2	120,773,034 (GRCm39)	missense	probably benign	0.35
R2147:Ubr1	UTSW	2	120,694,811 (GRCm39)	missense	probably damaging	1.00
R2191:Ubr1	UTSW	2	120,756,528 (GRCm39)	missense	probably damaging	0.96
R2288:Ubr1	UTSW	2	120,739,963 (GRCm39)	missense	probably damaging	1.00
R3409:Ubr1	UTSW	2	120,793,929 (GRCm39)	missense	probably benign	0.02
R3930:Ubr1	UTSW	2	120,746,951 (GRCm39)	missense	probably benign	0.20
R3979:Ubr1	UTSW	2	120,693,168 (GRCm39)	missense	probably benign	0.11
R4172:Ubr1	UTSW	2	120,777,103 (GRCm39)	splice site	probably null
R4173:Ubr1	UTSW	2	120,777,103 (GRCm39)	splice site	probably null
R4174:Ubr1	UTSW	2	120,777,103 (GRCm39)	splice site	probably null
R4241:Ubr1	UTSW	2	120,764,867 (GRCm39)	missense	possibly damaging	0.69
R4366:Ubr1	UTSW	2	120,801,084 (GRCm39)	utr 5 prime	probably benign
R4371:Ubr1	UTSW	2	120,725,547 (GRCm39)	splice site	probably null
R4533:Ubr1	UTSW	2	120,772,963 (GRCm39)	missense	possibly damaging	0.86
R4656:Ubr1	UTSW	2	120,756,494 (GRCm39)	missense	probably benign	0.35
R4765:Ubr1	UTSW	2	120,793,923 (GRCm39)	nonsense	probably null
R4928:Ubr1	UTSW	2	120,745,419 (GRCm39)	missense	probably damaging	1.00
R4987:Ubr1	UTSW	2	120,794,047 (GRCm39)	missense	probably benign	0.00
R5033:Ubr1	UTSW	2	120,742,478 (GRCm39)	critical splice donor site	probably null
R5108:Ubr1	UTSW	2	120,793,903 (GRCm39)	missense	probably benign	0.20
R5118:Ubr1	UTSW	2	120,712,745 (GRCm39)	missense	probably benign	0.20
R5211:Ubr1	UTSW	2	120,723,651 (GRCm39)	missense	possibly damaging	0.92
R5215:Ubr1	UTSW	2	120,734,525 (GRCm39)	missense	probably benign	0.00
R5449:Ubr1	UTSW	2	120,793,981 (GRCm39)	missense	probably benign
R5452:Ubr1	UTSW	2	120,698,783 (GRCm39)	missense	possibly damaging	0.95
R5582:Ubr1	UTSW	2	120,745,888 (GRCm39)	missense	probably benign
R5610:Ubr1	UTSW	2	120,722,593 (GRCm39)	missense	probably benign	0.04
R5637:Ubr1	UTSW	2	120,793,998 (GRCm39)	missense	possibly damaging	0.68
R5808:Ubr1	UTSW	2	120,791,573 (GRCm39)	missense	possibly damaging	0.63
R5845:Ubr1	UTSW	2	120,734,486 (GRCm39)	missense	probably benign
R5979:Ubr1	UTSW	2	120,776,863 (GRCm39)	missense	probably benign	0.07
R6044:Ubr1	UTSW	2	120,693,202 (GRCm39)	missense	probably benign	0.38
R6146:Ubr1	UTSW	2	120,723,690 (GRCm39)	missense	probably damaging	0.98
R6252:Ubr1	UTSW	2	120,737,376 (GRCm39)	missense	probably benign	0.21
R6389:Ubr1	UTSW	2	120,711,520 (GRCm39)	missense	probably benign	0.03
R6600:Ubr1	UTSW	2	120,745,880 (GRCm39)	missense	probably benign	0.00
R6670:Ubr1	UTSW	2	120,754,611 (GRCm39)	critical splice donor site	probably null
R6731:Ubr1	UTSW	2	120,786,121 (GRCm39)	missense	probably null	0.99
R6836:Ubr1	UTSW	2	120,727,156 (GRCm39)	splice site	probably null
R6994:Ubr1	UTSW	2	120,794,074 (GRCm39)	missense	probably benign
R7121:Ubr1	UTSW	2	120,705,979 (GRCm39)	missense	probably benign	0.00
R7204:Ubr1	UTSW	2	120,734,558 (GRCm39)	missense	possibly damaging	0.49
R7209:Ubr1	UTSW	2	120,693,246 (GRCm39)	missense	probably benign	0.04
R7434:Ubr1	UTSW	2	120,693,161 (GRCm39)	missense	probably benign
R7457:Ubr1	UTSW	2	120,748,309 (GRCm39)	missense	probably benign	0.35
R7464:Ubr1	UTSW	2	120,720,255 (GRCm39)	critical splice donor site	probably null
R7519:Ubr1	UTSW	2	120,705,925 (GRCm39)	missense	possibly damaging	0.63
R7574:Ubr1	UTSW	2	120,703,672 (GRCm39)	missense	possibly damaging	0.93
R8030:Ubr1	UTSW	2	120,764,855 (GRCm39)	missense	probably damaging	0.99
R8085:Ubr1	UTSW	2	120,764,898 (GRCm39)	nonsense	probably null
R8221:Ubr1	UTSW	2	120,791,585 (GRCm39)	missense	probably damaging	0.97
R8241:Ubr1	UTSW	2	120,793,937 (GRCm39)	missense	possibly damaging	0.80
R8291:Ubr1	UTSW	2	120,741,596 (GRCm39)	missense	probably benign
R8293:Ubr1	UTSW	2	120,693,202 (GRCm39)	missense	probably benign	0.38
R8420:Ubr1	UTSW	2	120,701,476 (GRCm39)	missense	probably benign
R8489:Ubr1	UTSW	2	120,711,548 (GRCm39)	missense	probably benign	0.42
R8708:Ubr1	UTSW	2	120,696,964 (GRCm39)	missense	probably benign	0.27
R8856:Ubr1	UTSW	2	120,734,523 (GRCm39)	missense	probably damaging	1.00
R8995:Ubr1	UTSW	2	120,697,034 (GRCm39)	missense	probably damaging	1.00
R9153:Ubr1	UTSW	2	120,756,469 (GRCm39)	missense	probably benign	0.00
R9155:Ubr1	UTSW	2	120,754,615 (GRCm39)	missense	possibly damaging	0.84
R9156:Ubr1	UTSW	2	120,703,603 (GRCm39)	critical splice donor site	probably null
R9194:Ubr1	UTSW	2	120,778,325 (GRCm39)	missense	probably damaging	1.00
R9320:Ubr1	UTSW	2	120,727,000 (GRCm39)	missense	probably benign	0.04
R9401:Ubr1	UTSW	2	120,765,765 (GRCm39)	missense	probably benign	0.06
R9430:Ubr1	UTSW	2	120,734,506 (GRCm39)	missense	possibly damaging	0.59
R9515:Ubr1	UTSW	2	120,703,627 (GRCm39)	missense	probably damaging	1.00
R9623:Ubr1	UTSW	2	120,764,820 (GRCm39)	missense	probably benign	0.06
R9703:Ubr1	UTSW	2	120,732,092 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGCCTGGCAAAATATCTGTC -3'
(R):5'- TCTAGGAGCCTAAGTAGAAAAGCC -3'

Sequencing Primer
(F):5'- GGCCTGGCAAAATATCTGTCTAAAG -3'
(R):5'- AAAGCCAAGTGAGGTTATTGTTGCC -3'

Posted On

2015-07-21