Incidental Mutation 'R4450:Tln2'
ID328933
Institutional Source Beutler Lab
Gene Symbol Tln2
Ensembl Gene ENSMUSG00000052698
Gene Nametalin 2
Synonyms
MMRRC Submission 041711-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R4450 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location67217087-67559703 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 67344065 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039662] [ENSMUST00000040025] [ENSMUST00000215784]
Predicted Effect probably null
Transcript: ENSMUST00000039662
SMART Domains Protein: ENSMUSP00000035272
Gene: ENSMUSG00000052698

DomainStartEndE-ValueType
B41 84 316 1.29e-66 SMART
IRS 311 404 6.31e-17 SMART
Pfam:Talin_middle 494 655 3.4e-59 PFAM
Pfam:I_LWEQ 661 765 1.9e-10 PFAM
low complexity region 770 778 N/A INTRINSIC
PDB:2L7A|A 797 901 3e-44 PDB
low complexity region 902 918 N/A INTRINSIC
low complexity region 923 946 N/A INTRINSIC
internal_repeat_4 973 1033 7.18e-6 PROSPERO
internal_repeat_3 1083 1210 3.53e-6 PROSPERO
internal_repeat_4 1138 1198 7.18e-6 PROSPERO
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1330 1343 N/A INTRINSIC
internal_repeat_1 1482 1554 2.88e-9 PROSPERO
internal_repeat_2 1491 1551 2.05e-7 PROSPERO
low complexity region 1679 1690 N/A INTRINSIC
Pfam:VBS 1850 1974 2.6e-67 PFAM
internal_repeat_3 2010 2138 3.53e-6 PROSPERO
low complexity region 2309 2325 N/A INTRINSIC
low complexity region 2349 2359 N/A INTRINSIC
Pfam:I_LWEQ 2384 2531 2.5e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000040025
SMART Domains Protein: ENSMUSP00000039633
Gene: ENSMUSG00000052698

DomainStartEndE-ValueType
B41 84 316 1.29e-66 SMART
IRS 311 404 6.31e-17 SMART
Pfam:Talin_middle 494 655 8.5e-78 PFAM
low complexity region 674 693 N/A INTRINSIC
internal_repeat_2 703 763 2.05e-7 PROSPERO
low complexity region 770 778 N/A INTRINSIC
PDB:2L7A|A 797 901 3e-44 PDB
low complexity region 902 918 N/A INTRINSIC
low complexity region 923 946 N/A INTRINSIC
internal_repeat_4 973 1033 7.18e-6 PROSPERO
internal_repeat_3 1083 1210 3.53e-6 PROSPERO
internal_repeat_4 1138 1198 7.18e-6 PROSPERO
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1330 1343 N/A INTRINSIC
internal_repeat_1 1482 1554 2.88e-9 PROSPERO
internal_repeat_2 1491 1551 2.05e-7 PROSPERO
low complexity region 1679 1690 N/A INTRINSIC
Pfam:VBS 1850 1974 9.9e-72 PFAM
internal_repeat_3 2010 2138 3.53e-6 PROSPERO
low complexity region 2309 2325 N/A INTRINSIC
low complexity region 2349 2359 N/A INTRINSIC
Pfam:I_LWEQ 2383 2533 4.3e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215784
Meta Mutation Damage Score 0.572 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to talin 1, a cytoskeletal protein that plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. This protein has a different pattern of expression compared to talin 1 but, like talin 1, is thought to associate with unique transmembrane receptors to form novel linkages between extracellular matrices and the actin cytoskeleton. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal muscle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsl6 A G 11: 54,328,403 D278G probably damaging Het
Adamdec1 C T 14: 68,573,119 R196Q probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Angel1 A T 12: 86,721,924 Y262N probably damaging Het
Arhgef18 A G 8: 3,437,097 E272G probably damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Brca2 T G 5: 150,536,053 D264E probably damaging Het
Cdca4 T C 12: 112,821,658 N150S probably benign Het
Cep162 T C 9: 87,225,808 S510G probably damaging Het
Cldn12 T C 5: 5,508,398 T10A probably damaging Het
Clip2 C T 5: 134,502,953 G631D possibly damaging Het
Col19a1 T A 1: 24,322,035 T625S probably damaging Het
Col6a5 C T 9: 105,904,521 G1635D unknown Het
Dcp1b A G 6: 119,206,476 T175A probably benign Het
Eln C T 5: 134,725,781 probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm9894 T A 13: 67,765,080 noncoding transcript Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hrasls C T 16: 29,228,224 T165M possibly damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Klhl42 G A 6: 147,091,671 G47D probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lzts2 A T 19: 45,023,593 K154* probably null Het
Map4k3 C T 17: 80,603,982 probably null Het
Mlc1 A G 15: 88,963,490 F285S probably benign Het
Myo5a T A 9: 75,167,176 M789K probably benign Het
Nbeal1 T A 1: 60,267,774 S319T probably damaging Het
Nsun4 A T 4: 116,051,256 Y702* probably null Het
Olfr917 A T 9: 38,665,754 V30E probably benign Het
Olfr954 G A 9: 39,462,032 M200I probably benign Het
Osbpl5 T A 7: 143,694,906 T640S probably benign Het
Rangrf A T 11: 68,975,184 probably benign Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Ros1 C T 10: 52,077,942 G1867D probably damaging Het
Slc11a1 C A 1: 74,385,535 probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Syt6 A G 3: 103,585,645 H156R probably benign Het
Trim58 T C 11: 58,651,365 W384R probably benign Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Tln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tln2 APN 9 67344187 missense possibly damaging 0.59
IGL01110:Tln2 APN 9 67250582 nonsense probably null
IGL01112:Tln2 APN 9 67311811 missense probably damaging 1.00
IGL01307:Tln2 APN 9 67395467 missense probably benign 0.25
IGL01374:Tln2 APN 9 67261923 missense probably damaging 1.00
IGL01625:Tln2 APN 9 67370623 missense probably damaging 1.00
IGL01865:Tln2 APN 9 67250614 nonsense probably null
IGL01999:Tln2 APN 9 67392505 missense possibly damaging 0.81
IGL02002:Tln2 APN 9 67356698 missense probably damaging 0.98
IGL02005:Tln2 APN 9 67392505 missense possibly damaging 0.81
IGL02015:Tln2 APN 9 67361439 splice site probably benign
IGL02368:Tln2 APN 9 67240810 splice site probably benign
IGL02444:Tln2 APN 9 67258592 splice site probably benign
IGL02646:Tln2 APN 9 67255996 missense probably benign 0.43
IGL02744:Tln2 APN 9 67229376 nonsense probably null
IGL02869:Tln2 APN 9 67221525 splice site probably benign
IGL02930:Tln2 APN 9 67393662 nonsense probably null
IGL03100:Tln2 APN 9 67295737 missense probably damaging 1.00
IGL03326:Tln2 APN 9 67334257 missense possibly damaging 0.67
R0047:Tln2 UTSW 9 67240672 splice site probably benign
R0047:Tln2 UTSW 9 67240672 splice site probably benign
R0107:Tln2 UTSW 9 67370706 missense probably damaging 1.00
R0494:Tln2 UTSW 9 67355197 missense probably benign 0.22
R0884:Tln2 UTSW 9 67370733 missense probably damaging 1.00
R0947:Tln2 UTSW 9 67295813 missense probably benign 0.08
R0989:Tln2 UTSW 9 67229454 missense probably damaging 1.00
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1195:Tln2 UTSW 9 67258566 missense probably damaging 0.96
R1486:Tln2 UTSW 9 67311839 missense probably damaging 1.00
R1527:Tln2 UTSW 9 67272668 missense possibly damaging 0.95
R1584:Tln2 UTSW 9 67296414 missense probably damaging 1.00
R1636:Tln2 UTSW 9 67306532 missense probably damaging 1.00
R1656:Tln2 UTSW 9 67227107 missense possibly damaging 0.81
R1707:Tln2 UTSW 9 67375807 missense probably benign 0.00
R1749:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1751:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1761:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1767:Tln2 UTSW 9 67286514 missense probably benign 0.01
R1815:Tln2 UTSW 9 67229423 missense probably damaging 1.00
R1840:Tln2 UTSW 9 67342043 missense probably damaging 1.00
R1847:Tln2 UTSW 9 67362687 nonsense probably null
R1964:Tln2 UTSW 9 67342135 missense probably benign 0.00
R1968:Tln2 UTSW 9 67255901 missense probably damaging 1.00
R2036:Tln2 UTSW 9 67272704 missense possibly damaging 0.76
R2038:Tln2 UTSW 9 67397653 start codon destroyed probably benign 0.01
R2152:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2153:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2154:Tln2 UTSW 9 67302560 missense probably damaging 1.00
R2191:Tln2 UTSW 9 67355221 missense probably damaging 1.00
R2192:Tln2 UTSW 9 67355221 missense probably damaging 1.00
R2201:Tln2 UTSW 9 67375757 missense probably damaging 1.00
R3116:Tln2 UTSW 9 67355139 missense probably benign 0.10
R3151:Tln2 UTSW 9 67330547 critical splice donor site probably null
R3795:Tln2 UTSW 9 67255915 missense probably damaging 0.97
R3953:Tln2 UTSW 9 67370629 missense probably damaging 1.00
R4685:Tln2 UTSW 9 67302572 missense probably damaging 1.00
R4688:Tln2 UTSW 9 67397653 start codon destroyed probably benign 0.01
R4696:Tln2 UTSW 9 67395461 missense probably damaging 1.00
R4697:Tln2 UTSW 9 67395461 missense probably damaging 1.00
R4700:Tln2 UTSW 9 67346527 missense probably benign 0.03
R4701:Tln2 UTSW 9 67346527 missense probably benign 0.03
R4741:Tln2 UTSW 9 67386555 critical splice donor site probably null
R4806:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4807:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4808:Tln2 UTSW 9 67331733 missense probably benign 0.29
R4967:Tln2 UTSW 9 67355125 missense probably damaging 0.97
R5061:Tln2 UTSW 9 67354468 missense probably benign
R5092:Tln2 UTSW 9 67256028 missense probably benign 0.13
R5093:Tln2 UTSW 9 67334314 missense probably benign 0.44
R5126:Tln2 UTSW 9 67258535 missense probably damaging 1.00
R5204:Tln2 UTSW 9 67354482 missense probably benign 0.00
R5236:Tln2 UTSW 9 67365923 missense probably damaging 0.99
R5287:Tln2 UTSW 9 67242359 missense probably damaging 1.00
R5568:Tln2 UTSW 9 67311865 missense probably damaging 1.00
R5571:Tln2 UTSW 9 67334320 missense possibly damaging 0.88
R5642:Tln2 UTSW 9 67296358 missense probably benign 0.01
R5711:Tln2 UTSW 9 67392547 missense probably benign 0.00
R5776:Tln2 UTSW 9 67258250 missense probably damaging 1.00
R5791:Tln2 UTSW 9 67386605 missense probably damaging 0.98
R5866:Tln2 UTSW 9 67266868 missense probably damaging 1.00
R5888:Tln2 UTSW 9 67229403 missense probably damaging 1.00
R5902:Tln2 UTSW 9 67362717 missense probably benign 0.02
R6106:Tln2 UTSW 9 67323020 missense probably damaging 0.99
R6175:Tln2 UTSW 9 67224081 missense probably damaging 1.00
R6385:Tln2 UTSW 9 67278129 missense probably benign 0.45
R6430:Tln2 UTSW 9 67272665 missense probably damaging 1.00
R6441:Tln2 UTSW 9 67272689 missense probably damaging 1.00
R6738:Tln2 UTSW 9 67386664 missense possibly damaging 0.91
R6776:Tln2 UTSW 9 67262905 missense probably damaging 1.00
R6794:Tln2 UTSW 9 67286558 missense probably benign 0.07
R6850:Tln2 UTSW 9 67258535 missense probably damaging 1.00
R6907:Tln2 UTSW 9 67397635 missense probably damaging 0.98
R6909:Tln2 UTSW 9 67392532 missense probably damaging 0.97
R6951:Tln2 UTSW 9 67258485 missense probably damaging 0.97
X0027:Tln2 UTSW 9 67376853 missense probably damaging 1.00
X0064:Tln2 UTSW 9 67348138 missense probably damaging 1.00
X0067:Tln2 UTSW 9 67370691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGTCTGCGCTAAGTCAG -3'
(R):5'- ATCATGTTCAGACAGAATGGCG -3'

Sequencing Primer
(F):5'- AGCATCTCTTTCTTGTGTTCAACAAC -3'
(R):5'- ACTTACTGTCCTGTCTTCTAGGTGAG -3'
Posted On2015-07-21