Mutagenetix > Incidental Mutations

Incidental Mutation 'R4450:Col6a5'

328936

Institutional Source

Beutler Lab

Gene Symbol

Col6a5

Ensembl Gene

ENSMUSG00000091345

Gene Name

collagen, type VI, alpha 5

Synonyms

Gm7455, Col6a5

MMRRC Submission

041711-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.907) question?

Stock #

R4450 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105856078-105960643 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 105904521 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 1635 (G1635D)

Ref Sequence

ENSEMBL: ENSMUSP00000139398 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165165] [ENSMUST00000190193]

Predicted Effect

unknown
Transcript: ENSMUST00000165165
AA Change: G1635D

SMART Domains

Protein: ENSMUSP00000131146
Gene: ENSMUSG00000091345
AA Change: G1635D

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
VWA	28	200	1.8e-24	SMART
low complexity region	222	248	N/A	INTRINSIC
VWA	266	439	2.23e-20	SMART
VWA	472	649	6.84e-39	SMART
VWA	658	834	1.52e-45	SMART
VWA	844	1024	2.44e-44	SMART
VWA	1035	1208	2.95e-20	SMART
Pfam:Collagen	1425	1478	3.3e-8	PFAM
low complexity region	1493	1508	N/A	INTRINSIC
low complexity region	1535	1552	N/A	INTRINSIC
Pfam:Collagen	1555	1616	9.6e-10	PFAM
low complexity region	1711	1730	N/A	INTRINSIC
low complexity region	1739	1757	N/A	INTRINSIC
VWA	1788	1964	1.99e-17	SMART
VWA	1994	2173	5.98e-21	SMART
VWA	2319	2513	4.4e-19	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000190193
AA Change: G1635D

SMART Domains

Protein: ENSMUSP00000139398
Gene: ENSMUSG00000091345
AA Change: G1635D

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
VWA	28	200	1.1e-26	SMART
low complexity region	222	248	N/A	INTRINSIC
VWA	266	439	1.4e-22	SMART
VWA	472	649	4.4e-41	SMART
VWA	658	834	9.5e-48	SMART
VWA	844	1024	1.6e-46	SMART
VWA	1035	1208	1.9e-22	SMART
Pfam:Collagen	1425	1478	1.2e-6	PFAM
Pfam:Collagen	1457	1530	5.9e-6	PFAM
low complexity region	1535	1552	N/A	INTRINSIC
Pfam:Collagen	1555	1616	3.6e-8	PFAM
Pfam:Collagen	1631	1691	8.4e-6	PFAM
Pfam:Collagen	1706	1764	6.6e-6	PFAM
VWA	1788	1964	1.2e-19	SMART
VWA	1994	2173	3.7e-23	SMART
VWA	2319	2513	2.8e-21	SMART

Meta Mutation Damage Score

0.0612

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the collagen superfamily of proteins. The encoded protein contains multiple von Willebrand factor A-like domains and may interact with the alpha 1 and alpha 2 chains of collagen VI to form the complete collagen VI trimer. Polymorphisms in this gene may be linked to dermal phenotypes, such as eczema. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3930402G23Rik	T	A	8: 10,926,129		noncoding transcript	Het
Acsl6	A	G	11: 54,328,403	D278G	probably damaging	Het
Adamdec1	C	T	14: 68,573,119	R196Q	probably benign	Het
Akap13	T	A	7: 75,742,760	F2450L	probably damaging	Het
Alg11	C	A	8: 22,068,079	A469E	probably benign	Het
Angel1	A	T	12: 86,721,924	Y262N	probably damaging	Het
Arhgef18	A	G	8: 3,437,097	E272G	probably damaging	Het
Bpifb6	A	G	2: 153,906,768	E228G	possibly damaging	Het
Brca2	T	G	5: 150,536,053	D264E	probably damaging	Het
Cdca4	T	C	12: 112,821,658	N150S	probably benign	Het
Cep162	T	C	9: 87,225,808	S510G	probably damaging	Het
Cldn12	T	C	5: 5,508,398	T10A	probably damaging	Het
Clip2	C	T	5: 134,502,953	G631D	possibly damaging	Het
Col19a1	T	A	1: 24,322,035	T625S	probably damaging	Het
Dcp1b	A	G	6: 119,206,476	T175A	probably benign	Het
Eln	C	T	5: 134,725,781		probably benign	Het
Galnt2	A	G	8: 124,295,377	D14G	probably benign	Het
Gm9894	T	A	13: 67,765,080		noncoding transcript	Het
Herc2	T	C	7: 56,227,892	L4569P	probably damaging	Het
Hrasls	C	T	16: 29,228,224	T165M	possibly damaging	Het
Iqcm	T	C	8: 75,629,766	S176P	probably damaging	Het
Klhl42	G	A	6: 147,091,671	G47D	probably benign	Het
Lmo2	T	C	2: 103,981,062	Y147H	probably damaging	Het
Lzts2	A	T	19: 45,023,593	K154*	probably null	Het
Map4k3	C	T	17: 80,603,982		probably null	Het
Mlc1	A	G	15: 88,963,490	F285S	probably benign	Het
Myo5a	T	A	9: 75,167,176	M789K	probably benign	Het
Nbeal1	T	A	1: 60,267,774	S319T	probably damaging	Het
Nsun4	A	T	4: 116,051,256	Y702*	probably null	Het
Olfr917	A	T	9: 38,665,754	V30E	probably benign	Het
Olfr954	G	A	9: 39,462,032	M200I	probably benign	Het
Osbpl5	T	A	7: 143,694,906	T640S	probably benign	Het
Rangrf	A	T	11: 68,975,184		probably benign	Het
Rnpc3	T	C	3: 113,611,137		probably benign	Het
Ros1	C	T	10: 52,077,942	G1867D	probably damaging	Het
Slc11a1	C	A	1: 74,385,535		probably benign	Het
Slc15a4	A	G	5: 127,604,536		probably null	Het
Speer3	C	G	5: 13,796,380	A238G	possibly damaging	Het
Syt6	A	G	3: 103,585,645	H156R	probably benign	Het
Tln2	C	T	9: 67,344,065		probably null	Het
Trim58	T	C	11: 58,651,365	W384R	probably benign	Het
Wwc2	A	G	8: 47,868,667	Y471H	unknown	Het

Other mutations in Col6a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Col6a5	APN	9	105882683	missense	probably damaging	1.00
IGL01462:Col6a5	APN	9	105946075	missense	unknown
IGL01530:Col6a5	APN	9	105915186	splice site	probably benign
IGL01717:Col6a5	APN	9	105940273	missense	unknown
IGL01859:Col6a5	APN	9	105930961	nonsense	probably null
IGL01945:Col6a5	APN	9	105928290	missense	unknown
IGL01985:Col6a5	APN	9	105937283	missense	unknown
IGL02128:Col6a5	APN	9	105939894	missense	unknown
IGL02170:Col6a5	APN	9	105928422	missense	unknown
IGL02224:Col6a5	APN	9	105864335	missense	probably damaging	1.00
IGL02246:Col6a5	APN	9	105911107	nonsense	probably null
IGL02304:Col6a5	APN	9	105928414	missense	unknown
IGL02338:Col6a5	APN	9	105878630	missense	probably damaging	1.00
IGL02375:Col6a5	APN	9	105906113	missense	unknown
IGL02660:Col6a5	APN	9	105936886	missense	unknown
IGL02829:Col6a5	APN	9	105934307	missense	unknown
IGL02882:Col6a5	APN	9	105934321	missense	unknown
IGL02973:Col6a5	APN	9	105925821	missense	unknown
IGL03089:Col6a5	APN	9	105933839	missense	unknown
IGL03100:Col6a5	APN	9	105937313	missense	unknown
IGL03257:Col6a5	APN	9	105881873	missense	possibly damaging	0.95
FR4340:Col6a5	UTSW	9	105934174	missense	unknown
FR4342:Col6a5	UTSW	9	105934174	missense	unknown
FR4589:Col6a5	UTSW	9	105934174	missense	unknown
PIT4131001:Col6a5	UTSW	9	105881914	missense	probably damaging	0.98
R0147:Col6a5	UTSW	9	105925794	missense	unknown
R0549:Col6a5	UTSW	9	105904579	splice site	probably benign
R0622:Col6a5	UTSW	9	105925852	missense	unknown
R0628:Col6a5	UTSW	9	105912450	splice site	probably null
R0635:Col6a5	UTSW	9	105928606	missense	unknown
R0644:Col6a5	UTSW	9	105948324	critical splice donor site	probably null
R0828:Col6a5	UTSW	9	105862064	critical splice acceptor site	probably null
R0972:Col6a5	UTSW	9	105940285	missense	unknown
R1065:Col6a5	UTSW	9	105881783	missense	probably damaging	0.99
R1142:Col6a5	UTSW	9	105934317	missense	unknown
R1169:Col6a5	UTSW	9	105896974	splice site	probably null
R1522:Col6a5	UTSW	9	105939994	missense	unknown
R1646:Col6a5	UTSW	9	105862749	nonsense	probably null
R1719:Col6a5	UTSW	9	105931293	missense	unknown
R1759:Col6a5	UTSW	9	105930846	missense	unknown
R1780:Col6a5	UTSW	9	105936878	missense	unknown
R1812:Col6a5	UTSW	9	105928054	missense	unknown
R1838:Col6a5	UTSW	9	105864833	missense	probably benign	0.28
R1839:Col6a5	UTSW	9	105864833	missense	probably benign	0.28
R1863:Col6a5	UTSW	9	105940201	missense	unknown
R1900:Col6a5	UTSW	9	105931213	missense	unknown
R1951:Col6a5	UTSW	9	105936957	missense	unknown
R2024:Col6a5	UTSW	9	105936994	missense	unknown
R2126:Col6a5	UTSW	9	105945600	missense	unknown
R2319:Col6a5	UTSW	9	105937218	missense	unknown
R2344:Col6a5	UTSW	9	105928537	missense	unknown
R2483:Col6a5	UTSW	9	105864148	missense	probably damaging	1.00
R3176:Col6a5	UTSW	9	105911107	nonsense	probably null
R3276:Col6a5	UTSW	9	105911107	nonsense	probably null
R3438:Col6a5	UTSW	9	105875792	missense	possibly damaging	0.88
R3791:Col6a5	UTSW	9	105864669	missense	probably damaging	0.99
R3840:Col6a5	UTSW	9	105928611	missense	unknown
R3886:Col6a5	UTSW	9	105930930	missense	unknown
R3941:Col6a5	UTSW	9	105939834	missense	unknown
R4194:Col6a5	UTSW	9	105945914	missense	unknown
R4399:Col6a5	UTSW	9	105888965	missense	possibly damaging	0.75
R4421:Col6a5	UTSW	9	105928473	missense	unknown
R4491:Col6a5	UTSW	9	105940012	missense	unknown
R4582:Col6a5	UTSW	9	105862764	missense	probably benign	0.17
R4693:Col6a5	UTSW	9	105937172	missense	unknown
R4787:Col6a5	UTSW	9	105931081	missense	unknown
R4789:Col6a5	UTSW	9	105937335	missense	unknown
R4791:Col6a5	UTSW	9	105930784	missense	unknown
R4792:Col6a5	UTSW	9	105930784	missense	unknown
R4817:Col6a5	UTSW	9	105934298	missense	unknown
R4854:Col6a5	UTSW	9	105898751	missense	probably benign	0.18
R4927:Col6a5	UTSW	9	105933964	missense	unknown
R4969:Col6a5	UTSW	9	105864607	missense	probably damaging	1.00
R5037:Col6a5	UTSW	9	105928138	missense	unknown
R5118:Col6a5	UTSW	9	105937005	missense	unknown
R5144:Col6a5	UTSW	9	105889283	missense	probably damaging	1.00
R5145:Col6a5	UTSW	9	105934245	missense	unknown
R5160:Col6a5	UTSW	9	105931009	missense	unknown
R5182:Col6a5	UTSW	9	105857332	nonsense	probably null
R5234:Col6a5	UTSW	9	105864205	missense	probably damaging	1.00
R5252:Col6a5	UTSW	9	105940290	missense	unknown
R5290:Col6a5	UTSW	9	105946083	missense	unknown
R5313:Col6a5	UTSW	9	105945544	missense	unknown
R5321:Col6a5	UTSW	9	105928465	missense	unknown
R5466:Col6a5	UTSW	9	105931083	missense	unknown
R5540:Col6a5	UTSW	9	105862776	missense	probably benign	0.44
R5669:Col6a5	UTSW	9	105925998	missense	unknown
R5789:Col6a5	UTSW	9	105864608	missense	possibly damaging	0.91
R5801:Col6a5	UTSW	9	105948367	missense	unknown
R5827:Col6a5	UTSW	9	105928120	nonsense	probably null
R5839:Col6a5	UTSW	9	105945393	critical splice donor site	probably null
R5908:Col6a5	UTSW	9	105862801	missense	possibly damaging	0.88
R5970:Col6a5	UTSW	9	105945847	missense	unknown
R6045:Col6a5	UTSW	9	105925918	missense	unknown
R6107:Col6a5	UTSW	9	105892272	nonsense	probably null
R6168:Col6a5	UTSW	9	105875787	critical splice donor site	probably null
R6315:Col6a5	UTSW	9	105881970	missense	probably damaging	1.00
R6317:Col6a5	UTSW	9	105889067	missense	probably damaging	1.00
R6414:Col6a5	UTSW	9	105892266	splice site	probably null
R6434:Col6a5	UTSW	9	105937345	missense	unknown
R6456:Col6a5	UTSW	9	105945477	missense	unknown
R6698:Col6a5	UTSW	9	105934175	missense	unknown
R6876:Col6a5	UTSW	9	105937307	missense	unknown
R6882:Col6a5	UTSW	9	105940270	nonsense	probably null
R6928:Col6a5	UTSW	9	105939919	missense	unknown
X0054:Col6a5	UTSW	9	105915158	missense	unknown
X0058:Col6a5	UTSW	9	105881778	nonsense	probably null
Z1088:Col6a5	UTSW	9	105926067	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TGAGCTGAGCGAAAACATGTATC -3'
(R):5'- CTGGGCTTGTCCACAGTTATTC -3'

Sequencing Primer
(F):5'- CTGAGCGAAAACATGTATCCATAG -3'
(R):5'- TCTCACAGCAGTAAGGTTGC -3'

Posted On

2015-07-21