Incidental Mutation 'R0044:Lpin1'
ID32898
Institutional Source Beutler Lab
Gene Symbol Lpin1
Ensembl Gene ENSMUSG00000020593
Gene Namelipin 1
SynonymsLipin1
MMRRC Submission 038338-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R0044 (G1)
Quality Score222
Status Validated (trace)
Chromosome12
Chromosomal Location16535669-16610966 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 16568529 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067124] [ENSMUST00000111067] [ENSMUST00000221230] [ENSMUST00000221297] [ENSMUST00000222989]
Predicted Effect probably benign
Transcript: ENSMUST00000067124
SMART Domains Protein: ENSMUSP00000070583
Gene: ENSMUSG00000020593

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 1.1e-48 PFAM
low complexity region 153 161 N/A INTRINSIC
low complexity region 230 242 N/A INTRINSIC
Pfam:Lipin_mid 498 591 9.4e-36 PFAM
low complexity region 630 642 N/A INTRINSIC
LNS2 708 864 3.42e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111067
SMART Domains Protein: ENSMUSP00000106696
Gene: ENSMUSG00000020593

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.2e-53 PFAM
low complexity region 153 161 N/A INTRINSIC
low complexity region 237 252 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
LNS2 675 831 3.42e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221230
Predicted Effect probably benign
Transcript: ENSMUST00000221297
Predicted Effect probably benign
Transcript: ENSMUST00000222989
Meta Mutation Damage Score 0.1224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a magnesium-ion-dependent phosphatidic acid phosphohydrolase enzyme that catalyzes the penultimate step in triglyceride synthesis including the dephosphorylation of phosphatidic acid to yield diacylglycerol. Expression of this gene is required for adipocyte differentiation and it also functions as a nuclear transcriptional coactivator with some peroxisome proliferator-activated receptors to modulate expression of other genes involved in lipid metabolism. Mutations in this gene are associated with metabolic syndrome, type 2 diabetes, acute recurrent rhabdomyolysis, and autosomal recessive acute recurrent myoglobinuria (ARARM). This gene is also a candidate for several human lipodystrophy syndromes. [provided by RefSeq, Mar 2017]
PHENOTYPE: ENU-induced mutants show transient hindlimb paralysis, demyelination and myelin sheath defects. Spontaneous mutants show neonatal fatty liver and hypertriglyceridemia, runting, male sterility, peripheral neuropathy, and altered hair growth, myelination, adipogenesis and lipid and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430571L13Rik A C 9: 107,342,499 R50S probably damaging Het
Actn2 G T 13: 12,275,127 T176N possibly damaging Het
Adamts7 T C 9: 90,171,588 V62A possibly damaging Het
Adcy2 A G 13: 68,727,899 S495P possibly damaging Het
Agbl3 A T 6: 34,799,899 M447L probably damaging Het
Asxl1 C T 2: 153,400,209 T893I probably benign Het
Atp11b T A 3: 35,812,252 I400N probably damaging Het
Bpifb2 C T 2: 153,882,679 probably benign Het
Capn1 T A 19: 6,014,343 Y42F probably benign Het
Cdk5rap2 A T 4: 70,360,901 L190H probably damaging Het
Cfap54 T C 10: 93,035,433 I594V probably null Het
Cpsf1 A G 15: 76,599,553 V830A probably benign Het
Cyp2c70 T A 19: 40,165,371 N258I possibly damaging Het
Dctn1 T G 6: 83,191,134 Y386D probably damaging Het
Degs2 T C 12: 108,692,154 N189D probably damaging Het
Dido1 C T 2: 180,661,819 A1431T probably damaging Het
Diras1 G T 10: 81,022,138 S93* probably null Het
E130308A19Rik T A 4: 59,690,290 H41Q possibly damaging Het
Ebf2 C T 14: 67,310,968 probably benign Het
Fcho2 A G 13: 98,755,544 probably benign Het
Gbe1 T A 16: 70,561,132 Y681* probably null Het
Gm10036 A C 18: 15,832,816 K8T probably benign Het
Herc1 T A 9: 66,448,175 M2236K probably benign Het
Hmcn2 A T 2: 31,412,508 Y2948F probably damaging Het
Jakmip2 A T 18: 43,582,105 C119S probably benign Het
Kif1b A G 4: 149,263,601 probably benign Het
Kif6 T C 17: 49,832,256 probably benign Het
Lrp2 T C 2: 69,527,555 I377V probably benign Het
Mavs C A 2: 131,242,024 T147N probably damaging Het
Mcoln2 C T 3: 146,183,561 T374M probably damaging Het
Mreg T G 1: 72,162,375 T153P probably damaging Het
Naglu T C 11: 101,071,217 I172T probably damaging Het
Ogdhl T C 14: 32,339,328 V492A possibly damaging Het
Olfr1245 A G 2: 89,575,630 I32T possibly damaging Het
Parvg A G 15: 84,337,882 E323G probably benign Het
Pgap1 A G 1: 54,493,368 L664S probably damaging Het
Pgm2l1 A G 7: 100,250,332 N51S probably benign Het
Pik3r6 A G 11: 68,544,750 T609A probably benign Het
Plcb4 T A 2: 135,971,856 V705E probably damaging Het
Plppr5 T A 3: 117,671,889 probably null Het
Prkg2 C A 5: 98,973,130 D411Y probably damaging Het
Ptprd A G 4: 76,086,329 V63A probably benign Het
Ptprz1 T A 6: 23,007,403 I1655N probably damaging Het
Raf1 T A 6: 115,623,515 D10V probably benign Het
Rexo1 T A 10: 80,544,378 Q928L probably benign Het
Rpl7l1 A C 17: 46,778,530 probably null Het
Rrm2b A G 15: 37,953,688 S39P possibly damaging Het
Scn5a A G 9: 119,492,047 probably null Het
Sgtb A G 13: 104,129,260 T93A probably benign Het
Sigirr G T 7: 141,092,313 probably null Het
Slc16a7 T C 10: 125,228,082 D462G probably benign Het
Slc25a30 C T 14: 75,769,649 A85T probably benign Het
Spata24 A G 18: 35,656,834 S167P probably damaging Het
Spock3 C T 8: 63,144,007 T115I possibly damaging Het
Srgap2 A G 1: 131,319,551 I581T possibly damaging Het
Syn2 A T 6: 115,135,147 M23L unknown Het
Synrg G A 11: 84,009,181 V839I probably damaging Het
Tmtc1 A G 6: 148,412,829 probably benign Het
Tnfaip3 C A 10: 19,011,626 M50I probably damaging Het
Topbp1 T A 9: 103,325,773 I721N possibly damaging Het
Ttc22 T G 4: 106,636,806 V321G probably benign Het
Ttc25 A T 11: 100,567,001 I477F probably damaging Het
Ubr2 A G 17: 46,992,985 probably benign Het
Ubr4 T C 4: 139,437,058 probably benign Het
Usp24 T C 4: 106,412,084 probably benign Het
Vmn2r100 A T 17: 19,522,179 I272L possibly damaging Het
Vrtn T A 12: 84,648,605 L43H probably damaging Het
Wnk1 G T 6: 120,037,149 R162S probably damaging Het
Xkr9 G A 1: 13,684,062 W93* probably null Het
Zfp804b G T 5: 6,769,655 P1136H probably damaging Het
Other mutations in Lpin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Lpin1 APN 12 16553992 missense probably benign 0.00
IGL00929:Lpin1 APN 12 16573699 missense probably benign 0.05
IGL01485:Lpin1 APN 12 16562357 splice site probably benign
IGL01750:Lpin1 APN 12 16577176 missense probably benign 0.00
IGL01774:Lpin1 APN 12 16558476 missense probably damaging 0.96
IGL02197:Lpin1 APN 12 16558407 critical splice donor site probably null
IGL02244:Lpin1 APN 12 16541769 missense probably damaging 0.99
IGL02272:Lpin1 APN 12 16547600 missense probably damaging 1.00
IGL03366:Lpin1 APN 12 16544677 missense probably damaging 1.00
lipin UTSW 12 16547499 missense probably damaging 1.00
R0106:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R0106:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R0676:Lpin1 UTSW 12 16540979 missense possibly damaging 0.88
R1119:Lpin1 UTSW 12 16563721 missense probably damaging 1.00
R1570:Lpin1 UTSW 12 16560998 missense possibly damaging 0.94
R1611:Lpin1 UTSW 12 16577218 missense probably null 0.64
R1646:Lpin1 UTSW 12 16573658 critical splice donor site probably null
R1756:Lpin1 UTSW 12 16538540 missense probably damaging 0.99
R1870:Lpin1 UTSW 12 16541743 missense probably damaging 1.00
R1912:Lpin1 UTSW 12 16546727 missense probably damaging 0.96
R1971:Lpin1 UTSW 12 16580723 missense probably damaging 1.00
R2484:Lpin1 UTSW 12 16547499 missense probably damaging 1.00
R2901:Lpin1 UTSW 12 16553998 missense probably benign
R3195:Lpin1 UTSW 12 16565583 missense possibly damaging 0.91
R3779:Lpin1 UTSW 12 16564568 missense probably damaging 0.96
R3918:Lpin1 UTSW 12 16571189 missense probably benign 0.00
R4532:Lpin1 UTSW 12 16553962 missense probably benign 0.01
R4857:Lpin1 UTSW 12 16563630 missense possibly damaging 0.86
R4882:Lpin1 UTSW 12 16538536 missense probably damaging 1.00
R5024:Lpin1 UTSW 12 16554006 missense probably benign 0.38
R5084:Lpin1 UTSW 12 16576982 missense probably damaging 1.00
R5108:Lpin1 UTSW 12 16573715 missense probably benign 0.39
R5191:Lpin1 UTSW 12 16580828 missense possibly damaging 0.95
R5377:Lpin1 UTSW 12 16563655 missense probably damaging 1.00
R5587:Lpin1 UTSW 12 16573714 missense probably damaging 1.00
R5659:Lpin1 UTSW 12 16540989 missense probably damaging 1.00
R5924:Lpin1 UTSW 12 16544657 missense possibly damaging 0.91
R6391:Lpin1 UTSW 12 16564553 missense probably benign 0.29
R6746:Lpin1 UTSW 12 16565528 missense probably benign
R6799:Lpin1 UTSW 12 16561044 missense probably damaging 1.00
R6969:Lpin1 UTSW 12 16580861 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCGATGCACCGTAACACTGAGATTC -3'
(R):5'- CAGTTTGTACCCAAGAACCCTTCCC -3'

Sequencing Primer
(F):5'- GTAACACTGAGATTCAAAGGCTTACC -3'
(R):5'- cctcctccttctctcctcc -3'
Posted On2013-05-09