Incidental Mutation 'R4452:Cdc27'
ID329020
Institutional Source Beutler Lab
Gene Symbol Cdc27
Ensembl Gene ENSMUSG00000020687
Gene Namecell division cycle 27
SynonymsAPC3
MMRRC Submission 041713-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R4452 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104502745-104550620 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104517395 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 563 (M563K)
Ref Sequence ENSEMBL: ENSMUSP00000091452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093923] [ENSMUST00000106961] [ENSMUST00000106962]
Predicted Effect probably benign
Transcript: ENSMUST00000093923
AA Change: M563K

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000091452
Gene: ENSMUSG00000020687
AA Change: M563K

DomainStartEndE-ValueType
Pfam:Apc3 17 95 2.2e-23 PFAM
TPR 115 148 4.45e-2 SMART
low complexity region 349 362 N/A INTRINSIC
TPR 500 533 1.33e1 SMART
TPR 568 601 2.91e-6 SMART
TPR 602 635 7.06e-5 SMART
TPR 636 669 3.96e-8 SMART
TPR 670 703 7.45e-4 SMART
TPR 704 737 6.92e1 SMART
TPR 738 771 1.17e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106961
SMART Domains Protein: ENSMUSP00000102574
Gene: ENSMUSG00000020687

DomainStartEndE-ValueType
Pfam:Apc3 17 95 1.9e-23 PFAM
Pfam:TPR_2 115 148 9.2e-5 PFAM
Pfam:TPR_1 116 148 9.1e-5 PFAM
low complexity region 355 368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106962
AA Change: M569K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102575
Gene: ENSMUSG00000020687
AA Change: M569K

DomainStartEndE-ValueType
Pfam:ANAPC3 17 94 7.7e-25 PFAM
TPR 115 148 4.45e-2 SMART
low complexity region 355 368 N/A INTRINSIC
TPR 506 539 1.33e1 SMART
TPR 574 607 2.91e-6 SMART
TPR 608 641 7.06e-5 SMART
TPR 642 675 3.96e-8 SMART
TPR 676 709 7.45e-4 SMART
TPR 710 743 6.92e1 SMART
TPR 744 777 1.17e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127506
Meta Mutation Damage Score 0.224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares strong similarity with Saccharomyces cerevisiae protein Cdc27, and the gene product of Schizosaccharomyces pombe nuc 2. This protein is a component of the anaphase-promoting complex (APC), which is composed of eight protein subunits and is highly conserved in eukaryotic cells. This complex catalyzes the formation of cyclin B-ubiquitin conjugate, which is responsible for the ubiquitin-mediated proteolysis of B-type cyclins. The protein encoded by this gene and three other members of the APC complex contain tetratricopeptide (TPR) repeats, which are important for protein-protein interactions. This protein was shown to interact with mitotic checkpoint proteins including Mad2, p55CDC and BUBR1, and it may thus be involved in controlling the timing of mitosis. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 2, 22 and Y. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,698,574 T145A possibly damaging Het
Adgra1 G T 7: 139,852,521 A92S probably benign Het
Aim2 A G 1: 173,455,444 T31A possibly damaging Het
Cd46 G A 1: 195,085,360 A131V possibly damaging Het
Chd9 A T 8: 90,977,680 N721I probably damaging Het
Cnn2 A G 10: 79,991,442 D49G probably benign Het
Cul1 T A 6: 47,508,989 Y323* probably null Het
D5Ertd579e A G 5: 36,616,470 W194R probably damaging Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Dnah9 C T 11: 66,027,082 A2249T probably damaging Het
Dppa4 T A 16: 48,289,336 D106E probably benign Het
Gja10 A G 4: 32,601,313 V357A probably benign Het
Gm20481 T G 17: 34,972,133 probably benign Het
Grxcr2 T C 18: 41,986,544 N244D probably damaging Het
Klk1b11 T A 7: 43,995,911 F3I probably damaging Het
Mid1 T C X: 169,927,425 V139A possibly damaging Het
Mycbp2 T C 14: 103,155,658 K3046E probably damaging Het
Nfasc T C 1: 132,634,671 N122S probably damaging Het
Olfr1099 C T 2: 86,958,699 G253D probably damaging Het
Olfr1232 T A 2: 89,325,253 D309V possibly damaging Het
Olfr556 T C 7: 102,670,049 V43A probably benign Het
Olfr655 T A 7: 104,596,639 M181L probably damaging Het
Olfr736 A T 14: 50,392,912 Y52F probably benign Het
Olfr933 T C 9: 38,976,086 S137P probably benign Het
P2ry10b C T X: 107,171,118 T28I probably damaging Het
Pdxdc1 T C 16: 13,837,126 Y675C possibly damaging Het
Plcl1 A G 1: 55,696,886 N462S probably benign Het
Ptf1a G T 2: 19,446,281 A141S possibly damaging Het
Pzp A G 6: 128,491,240 L1028P probably damaging Het
Qrsl1 A G 10: 43,882,162 S312P probably damaging Het
Sars2 A G 7: 28,750,093 T349A probably benign Het
Scarb1 A T 5: 125,300,345 F208I probably damaging Het
Scn8a A G 15: 100,957,091 N153S possibly damaging Het
Sema4c A T 1: 36,553,756 V127D probably benign Het
Smg6 C G 11: 74,990,141 S931C probably benign Het
Trpm2 A T 10: 77,923,593 L1119Q probably damaging Het
Ubtd2 T A 11: 32,499,406 N84K probably damaging Het
Ugt2b35 A T 5: 87,003,378 H281L probably damaging Het
Umodl1 T C 17: 30,994,815 probably null Het
Other mutations in Cdc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Cdc27 APN 11 104521432 missense probably benign 0.01
IGL00673:Cdc27 APN 11 104528435 missense probably damaging 1.00
IGL00949:Cdc27 APN 11 104529403 missense probably damaging 1.00
IGL01529:Cdc27 APN 11 104507216 missense probably damaging 1.00
IGL01894:Cdc27 APN 11 104526921 missense probably benign 0.00
IGL02096:Cdc27 APN 11 104528568 splice site probably benign
IGL02124:Cdc27 APN 11 104522731 missense probably damaging 0.99
IGL02444:Cdc27 APN 11 104522716 splice site probably benign
IGL02589:Cdc27 APN 11 104505644 missense probably benign 0.04
IGL02851:Cdc27 APN 11 104526981 splice site probably benign
IGL02861:Cdc27 APN 11 104522831 splice site probably benign
IGL02952:Cdc27 APN 11 104517464 missense probably damaging 1.00
IGL03103:Cdc27 APN 11 104512980 missense probably benign 0.21
R0344:Cdc27 UTSW 11 104526991 splice site probably benign
R0365:Cdc27 UTSW 11 104528424 missense possibly damaging 0.68
R0366:Cdc27 UTSW 11 104505648 missense probably damaging 0.99
R0426:Cdc27 UTSW 11 104513027 splice site probably null
R0505:Cdc27 UTSW 11 104528288 missense probably benign
R0639:Cdc27 UTSW 11 104531734 missense probably damaging 1.00
R0925:Cdc27 UTSW 11 104526049 critical splice donor site probably null
R0927:Cdc27 UTSW 11 104505641 missense possibly damaging 0.88
R1414:Cdc27 UTSW 11 104521425 missense probably benign 0.26
R1765:Cdc27 UTSW 11 104534781 missense probably damaging 1.00
R1822:Cdc27 UTSW 11 104522822 missense probably benign 0.16
R2449:Cdc27 UTSW 11 104505638 missense probably benign 0.03
R3404:Cdc27 UTSW 11 104507200 missense probably damaging 1.00
R3405:Cdc27 UTSW 11 104507200 missense probably damaging 1.00
R3406:Cdc27 UTSW 11 104507200 missense probably damaging 1.00
R3776:Cdc27 UTSW 11 104515437 missense probably damaging 1.00
R4037:Cdc27 UTSW 11 104507207 missense probably damaging 1.00
R4385:Cdc27 UTSW 11 104534814 missense probably benign 0.10
R4451:Cdc27 UTSW 11 104517395 missense probably benign 0.05
R4530:Cdc27 UTSW 11 104528426 missense possibly damaging 0.68
R4956:Cdc27 UTSW 11 104529395 missense probably damaging 0.99
R4988:Cdc27 UTSW 11 104526124 missense possibly damaging 0.95
R5098:Cdc27 UTSW 11 104507287 missense probably damaging 1.00
R5130:Cdc27 UTSW 11 104534774 missense probably benign 0.07
R5384:Cdc27 UTSW 11 104507140 missense probably benign 0.02
R5876:Cdc27 UTSW 11 104515418 missense probably benign 0.30
R6238:Cdc27 UTSW 11 104528444 missense probably damaging 1.00
R6318:Cdc27 UTSW 11 104528694 missense probably damaging 1.00
R6354:Cdc27 UTSW 11 104534748 missense probably damaging 1.00
R6467:Cdc27 UTSW 11 104522776 missense probably damaging 1.00
R6485:Cdc27 UTSW 11 104505648 missense probably benign 0.15
R7237:Cdc27 UTSW 11 104517419 missense probably benign
R7315:Cdc27 UTSW 11 104515444 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTGATACAGGACTAGATTTGTTCTG -3'
(R):5'- CATTCAGTCCTGGGAAGACAGTAG -3'

Sequencing Primer
(F):5'- TCTGATGATCAAAAGCTATGCTGGG -3'
(R):5'- AGACAGTAGCGGCACTGCAC -3'
Posted On2015-07-21