Incidental Mutation 'R4453:Ano7'
ID329034
Institutional Source Beutler Lab
Gene Symbol Ano7
Ensembl Gene ENSMUSG00000034107
Gene Nameanoctamin 7
SynonymsTmem16g, NGEP-L, IPCA-5, NGEP, Pcanap5
MMRRC Submission 041152-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R4453 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location93373930-93404303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93394353 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 361 (D361G)
Ref Sequence ENSEMBL: ENSMUSP00000140438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058682] [ENSMUST00000186641]
Predicted Effect probably damaging
Transcript: ENSMUST00000058682
AA Change: D361G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050495
Gene: ENSMUSG00000034107
AA Change: D361G

DomainStartEndE-ValueType
Pfam:Anoct_dimer 49 274 2.2e-63 PFAM
Pfam:Anoctamin 277 824 3.4e-146 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186641
AA Change: D361G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140438
Gene: ENSMUSG00000034107
AA Change: D361G

DomainStartEndE-ValueType
Pfam:Anoctamin 277 825 6.6e-150 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the anoctamin family, which in mammals is comprised of 10 members. Anoctamin proteins are proposed to have eight transmembrane domains with both termini facing the cytoplasm and a C-terminal domain of unknown function. While some members have been characterized as calcium-activated chloride channels, this protein is reported to have little anion conductance activity. In humans, this protein is primarily found in prostate tissues and may serve as a target for prostate cancer immunotherapy. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp10a TGGCGGCGGC TGGCGGC 7: 58,658,500 probably benign Het
Ccdc86 G T 19: 10,948,519 P239T probably damaging Het
Ces2h G A 8: 105,014,656 probably null Het
Ckap5 T A 2: 91,548,845 S43R probably damaging Het
Cpne6 G A 14: 55,512,597 V62M probably damaging Het
Dmbt1 T C 7: 131,040,934 C161R probably damaging Het
Dnajc10 T C 2: 80,346,623 S641P probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Grm2 G A 9: 106,653,879 T137I probably damaging Het
Gusb A G 5: 129,998,483 V327A possibly damaging Het
Helz C T 11: 107,672,629 Q1631* probably null Het
Hspa1a A G 17: 34,970,293 Y545H probably benign Het
Hus1 A T 11: 9,006,035 M166K probably damaging Het
Kcnh1 C A 1: 192,505,517 T762K probably damaging Het
Limd1 C A 9: 123,480,294 Q353K possibly damaging Het
Lipe T A 7: 25,397,690 K276I probably damaging Het
Ntpcr G A 8: 125,736,190 V49I probably benign Het
Olfr814 T C 10: 129,874,661 N32S probably null Het
Ppp1r1c A G 2: 79,708,231 I20V possibly damaging Het
Prdm13 G T 4: 21,679,464 A342E unknown Het
Prkd3 C A 17: 78,983,546 R180L probably damaging Het
Prune2 T C 19: 17,121,910 F1593L probably benign Het
Rims2 T A 15: 39,292,208 C95S probably damaging Het
Stard9 A G 2: 120,697,791 M1510V probably benign Het
Taf12 A G 4: 132,282,995 I92V probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tssk5 G A 15: 76,374,543 R48C probably benign Het
Wwtr1 T C 3: 57,575,259 probably null Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zfp473 T A 7: 44,733,254 T552S probably damaging Het
Zzef1 T C 11: 72,872,639 F1371L probably benign Het
Other mutations in Ano7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ano7 APN 1 93402166 missense probably benign 0.04
IGL00838:Ano7 APN 1 93402757 missense possibly damaging 0.91
IGL01295:Ano7 APN 1 93380478 missense probably benign 0.00
IGL01322:Ano7 APN 1 93395508 missense probably benign 0.08
IGL01807:Ano7 APN 1 93402696 missense possibly damaging 0.66
IGL01859:Ano7 APN 1 93394446 missense probably damaging 1.00
IGL02349:Ano7 APN 1 93391490 missense probably benign 0.02
IGL02976:Ano7 APN 1 93402673 missense possibly damaging 0.78
R0360:Ano7 UTSW 1 93388658 missense probably benign 0.01
R0364:Ano7 UTSW 1 93388658 missense probably benign 0.01
R0528:Ano7 UTSW 1 93395502 missense probably null 1.00
R0741:Ano7 UTSW 1 93401587 missense probably damaging 0.97
R1131:Ano7 UTSW 1 93401776 missense probably benign 0.24
R1156:Ano7 UTSW 1 93401852 unclassified probably null
R1500:Ano7 UTSW 1 93397328 missense probably damaging 1.00
R1710:Ano7 UTSW 1 93385624 missense probably benign 0.00
R2002:Ano7 UTSW 1 93400581 unclassified probably benign
R2062:Ano7 UTSW 1 93390313 missense probably benign
R2120:Ano7 UTSW 1 93402133 splice site probably benign
R2200:Ano7 UTSW 1 93380436 missense possibly damaging 0.93
R2268:Ano7 UTSW 1 93380439 missense possibly damaging 0.51
R2763:Ano7 UTSW 1 93399186 splice site probably null
R4202:Ano7 UTSW 1 93380478 missense probably benign 0.00
R4204:Ano7 UTSW 1 93380478 missense probably benign 0.00
R4205:Ano7 UTSW 1 93380478 missense probably benign 0.00
R4627:Ano7 UTSW 1 93375185 missense probably benign 0.15
R4735:Ano7 UTSW 1 93400494 missense probably benign
R4809:Ano7 UTSW 1 93394566 missense probably benign 0.20
R4935:Ano7 UTSW 1 93395314 missense possibly damaging 0.48
R4970:Ano7 UTSW 1 93397363 missense possibly damaging 0.77
R5112:Ano7 UTSW 1 93397363 missense possibly damaging 0.77
R5249:Ano7 UTSW 1 93375196 missense probably benign
R5813:Ano7 UTSW 1 93384919 critical splice donor site probably null
R6181:Ano7 UTSW 1 93395359 missense probably damaging 1.00
R7113:Ano7 UTSW 1 93385620 missense not run
Predicted Primers PCR Primer
(F):5'- CCGAGACTGAAACTAATTACTGTG -3'
(R):5'- AAGTAGGGCTCATCTTCCCC -3'

Sequencing Primer
(F):5'- GACTGAAACTAATTACTGTGGCTGC -3'
(R):5'- CTCCTGAAAGGGAGCTATGC -3'
Posted On2015-07-21