Incidental Mutation 'R4453:Limd1'
ID329053
Institutional Source Beutler Lab
Gene Symbol Limd1
Ensembl Gene ENSMUSG00000025239
Gene NameLIM domains containing 1
SynonymsD9Ertd192e
MMRRC Submission 041152-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock #R4453 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location123478706-123521552 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 123480294 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 353 (Q353K)
Ref Sequence ENSEMBL: ENSMUSP00000026269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026269]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026269
AA Change: Q353K

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026269
Gene: ENSMUSG00000025239
AA Change: Q353K

DomainStartEndE-ValueType
low complexity region 57 67 N/A INTRINSIC
low complexity region 238 252 N/A INTRINSIC
LIM 463 516 2.17e-15 SMART
LIM 528 580 9.6e-17 SMART
LIM 588 649 2.26e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216352
Predicted Effect probably benign
Transcript: ENSMUST00000217639
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal basal bone osteoclast numbers and bone density but are resistant to physiological and pathologic osteoclastogenic stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano7 A G 1: 93,394,353 D361G probably damaging Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,658,500 probably benign Het
Ccdc86 G T 19: 10,948,519 P239T probably damaging Het
Ces2h G A 8: 105,014,656 probably null Het
Ckap5 T A 2: 91,548,845 S43R probably damaging Het
Cpne6 G A 14: 55,512,597 V62M probably damaging Het
Dmbt1 T C 7: 131,040,934 C161R probably damaging Het
Dnajc10 T C 2: 80,346,623 S641P probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Grm2 G A 9: 106,653,879 T137I probably damaging Het
Gusb A G 5: 129,998,483 V327A possibly damaging Het
Helz C T 11: 107,672,629 Q1631* probably null Het
Hspa1a A G 17: 34,970,293 Y545H probably benign Het
Hus1 A T 11: 9,006,035 M166K probably damaging Het
Kcnh1 C A 1: 192,505,517 T762K probably damaging Het
Lipe T A 7: 25,397,690 K276I probably damaging Het
Ntpcr G A 8: 125,736,190 V49I probably benign Het
Olfr814 T C 10: 129,874,661 N32S probably null Het
Ppp1r1c A G 2: 79,708,231 I20V possibly damaging Het
Prdm13 G T 4: 21,679,464 A342E unknown Het
Prkd3 C A 17: 78,983,546 R180L probably damaging Het
Prune2 T C 19: 17,121,910 F1593L probably benign Het
Rims2 T A 15: 39,292,208 C95S probably damaging Het
Stard9 A G 2: 120,697,791 M1510V probably benign Het
Taf12 A G 4: 132,282,995 I92V probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tssk5 G A 15: 76,374,543 R48C probably benign Het
Wwtr1 T C 3: 57,575,259 probably null Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zfp473 T A 7: 44,733,254 T552S probably damaging Het
Zzef1 T C 11: 72,872,639 F1371L probably benign Het
Other mutations in Limd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Limd1 APN 9 123479883 missense probably benign 0.31
IGL00972:Limd1 APN 9 123480076 missense probably benign 0.06
IGL01815:Limd1 APN 9 123479736 missense probably benign 0.01
IGL02598:Limd1 APN 9 123516868 missense probably benign 0.11
IGL02598:Limd1 APN 9 123480171 missense probably benign
IGL02633:Limd1 APN 9 123479922 unclassified probably benign
IGL02999:Limd1 APN 9 123516799 missense probably damaging 1.00
R0314:Limd1 UTSW 9 123516827 missense probably benign 0.04
R1612:Limd1 UTSW 9 123518154 missense probably damaging 1.00
R2009:Limd1 UTSW 9 123479499 missense probably benign
R2299:Limd1 UTSW 9 123516877 nonsense probably null
R3791:Limd1 UTSW 9 123480374 missense possibly damaging 0.92
R5979:Limd1 UTSW 9 123479414 missense possibly damaging 0.96
X0028:Limd1 UTSW 9 123516862 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCATGGGCTTGGAGAATGG -3'
(R):5'- AGCACAGGTTCCAGACTACTG -3'

Sequencing Primer
(F):5'- AACTGTTTCAGCACCGATGG -3'
(R):5'- ACAGGTTCCAGACTACTGTCAGTG -3'
Posted On2015-07-21