Incidental Mutation 'R4453:Hus1'
ID329055
Institutional Source Beutler Lab
Gene Symbol Hus1
Ensembl Gene ENSMUSG00000020413
Gene NameHUS1 checkpoint clamp component
Synonyms
MMRRC Submission 041152-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4453 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location8993137-9011191 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9006035 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 166 (M166K)
Ref Sequence ENSEMBL: ENSMUSP00000020683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020683] [ENSMUST00000129115]
Predicted Effect probably damaging
Transcript: ENSMUST00000020683
AA Change: M166K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020683
Gene: ENSMUSG00000020413
AA Change: M166K

DomainStartEndE-ValueType
Pfam:Hus1 1 280 5.1e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127578
Predicted Effect probably benign
Transcript: ENSMUST00000129115
AA Change: M166K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114339
Gene: ENSMUSG00000020413
AA Change: M166K

DomainStartEndE-ValueType
Pfam:Hus1 1 280 4.8e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152890
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of a cell cycle checkpoint complex that causes cell cycle arrest in response to bulky DNA lesions and DNA replication blockage. Together with the proteins Rad9 and Rad1, the encoded protein forms a heterotrimeric complex known as the 9-1-1 complex. Mice lacking the encoded protein develop spontaneous chromosomal abnormalities resulting in embryonic lethality. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in yolk sac vascularization, placental abnormalities, extensive apoptosis, and midgestational lethality. Mutant cells show increased chromosomal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano7 A G 1: 93,394,353 D361G probably damaging Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,658,500 probably benign Het
Ccdc86 G T 19: 10,948,519 P239T probably damaging Het
Ces2h G A 8: 105,014,656 probably null Het
Ckap5 T A 2: 91,548,845 S43R probably damaging Het
Cpne6 G A 14: 55,512,597 V62M probably damaging Het
Dmbt1 T C 7: 131,040,934 C161R probably damaging Het
Dnajc10 T C 2: 80,346,623 S641P probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Grm2 G A 9: 106,653,879 T137I probably damaging Het
Gusb A G 5: 129,998,483 V327A possibly damaging Het
Helz C T 11: 107,672,629 Q1631* probably null Het
Hspa1a A G 17: 34,970,293 Y545H probably benign Het
Kcnh1 C A 1: 192,505,517 T762K probably damaging Het
Limd1 C A 9: 123,480,294 Q353K possibly damaging Het
Lipe T A 7: 25,397,690 K276I probably damaging Het
Ntpcr G A 8: 125,736,190 V49I probably benign Het
Olfr814 T C 10: 129,874,661 N32S probably null Het
Ppp1r1c A G 2: 79,708,231 I20V possibly damaging Het
Prdm13 G T 4: 21,679,464 A342E unknown Het
Prkd3 C A 17: 78,983,546 R180L probably damaging Het
Prune2 T C 19: 17,121,910 F1593L probably benign Het
Rims2 T A 15: 39,292,208 C95S probably damaging Het
Stard9 A G 2: 120,697,791 M1510V probably benign Het
Taf12 A G 4: 132,282,995 I92V probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tssk5 G A 15: 76,374,543 R48C probably benign Het
Wwtr1 T C 3: 57,575,259 probably null Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zfp473 T A 7: 44,733,254 T552S probably damaging Het
Zzef1 T C 11: 72,872,639 F1371L probably benign Het
Other mutations in Hus1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Hus1 APN 11 9000082 missense probably benign 0.00
IGL01974:Hus1 APN 11 9000088 missense possibly damaging 0.58
IGL02301:Hus1 APN 11 8996915 missense probably benign
IGL02436:Hus1 APN 11 9006057 missense possibly damaging 0.93
R0694:Hus1 UTSW 11 9007531 nonsense probably null
R2108:Hus1 UTSW 11 9011110 start codon destroyed probably null 1.00
R2128:Hus1 UTSW 11 9006011 missense probably damaging 1.00
R2329:Hus1 UTSW 11 9007492 critical splice donor site probably null
R4363:Hus1 UTSW 11 8998676 missense probably damaging 1.00
R4420:Hus1 UTSW 11 9000133 missense probably damaging 1.00
R4572:Hus1 UTSW 11 9007617 splice site probably null
R4818:Hus1 UTSW 11 8996808 utr 3 prime probably benign
R4913:Hus1 UTSW 11 8996856 missense probably benign 0.03
R4989:Hus1 UTSW 11 9006027 missense probably damaging 0.97
R5402:Hus1 UTSW 11 9010240 critical splice donor site probably null
R5902:Hus1 UTSW 11 9010669 intron probably benign
R6402:Hus1 UTSW 11 9010407 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGAGAAACCCACTAGCTG -3'
(R):5'- AGTCAGGCATCTTTACTTGCTTG -3'

Sequencing Primer
(F):5'- GAAACCCACTAGCTGATGGAG -3'
(R):5'- CAGGCATCTTTACTTGCTTGAATAAG -3'
Posted On2015-07-21