Incidental Mutation 'R4453:Cpne6'
ID329059
Institutional Source Beutler Lab
Gene Symbol Cpne6
Ensembl Gene ENSMUSG00000022212
Gene Namecopine VI
Synonymsneuronal copine
MMRRC Submission 041152-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.307) question?
Stock #R4453 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55510445-55517431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55512597 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 62 (V62M)
Ref Sequence ENSEMBL: ENSMUSP00000130799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074225] [ENSMUST00000076236] [ENSMUST00000163767] [ENSMUST00000165262] [ENSMUST00000165725] [ENSMUST00000171643] [ENSMUST00000226757] [ENSMUST00000228877]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074225
AA Change: V62M

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073847
Gene: ENSMUSG00000022212
AA Change: V62M

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076236
SMART Domains Protein: ENSMUSP00000075587
Gene: ENSMUSG00000022211

DomainStartEndE-ValueType
low complexity region 138 151 N/A INTRINSIC
internal_repeat_1 203 297 7.56e-6 PROSPERO
Blast:LRR 333 362 5e-10 BLAST
Blast:LRR 423 446 1e-5 BLAST
low complexity region 447 462 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
internal_repeat_1 496 593 7.56e-6 PROSPERO
Pfam:CARMIL_C 778 1065 5.3e-76 PFAM
low complexity region 1068 1117 N/A INTRINSIC
low complexity region 1137 1146 N/A INTRINSIC
low complexity region 1204 1216 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163767
AA Change: V62M

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126493
Gene: ENSMUSG00000022212
AA Change: V62M

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165262
AA Change: V62M

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132999
Gene: ENSMUSG00000022212
AA Change: V62M

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 505 2.34e-14 SMART
low complexity region 542 556 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165725
AA Change: V62M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130799
Gene: ENSMUSG00000022212
AA Change: V62M

DomainStartEndE-ValueType
C2 21 126 1.22e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170155
Predicted Effect possibly damaging
Transcript: ENSMUST00000171643
AA Change: V62M

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128555
Gene: ENSMUSG00000022212
AA Change: V62M

DomainStartEndE-ValueType
C2 21 126 6.65e-3 SMART
C2 155 258 7.51e-11 SMART
VWA 304 506 4.37e-14 SMART
low complexity region 543 557 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226388
Predicted Effect probably benign
Transcript: ENSMUST00000226757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228760
Predicted Effect probably benign
Transcript: ENSMUST00000228877
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene is one of several genes that encodes a calcium-dependent protein containing two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano7 A G 1: 93,394,353 D361G probably damaging Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,658,500 probably benign Het
Ccdc86 G T 19: 10,948,519 P239T probably damaging Het
Ces2h G A 8: 105,014,656 probably null Het
Ckap5 T A 2: 91,548,845 S43R probably damaging Het
Dmbt1 T C 7: 131,040,934 C161R probably damaging Het
Dnajc10 T C 2: 80,346,623 S641P probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Grm2 G A 9: 106,653,879 T137I probably damaging Het
Gusb A G 5: 129,998,483 V327A possibly damaging Het
Helz C T 11: 107,672,629 Q1631* probably null Het
Hspa1a A G 17: 34,970,293 Y545H probably benign Het
Hus1 A T 11: 9,006,035 M166K probably damaging Het
Kcnh1 C A 1: 192,505,517 T762K probably damaging Het
Limd1 C A 9: 123,480,294 Q353K possibly damaging Het
Lipe T A 7: 25,397,690 K276I probably damaging Het
Ntpcr G A 8: 125,736,190 V49I probably benign Het
Olfr814 T C 10: 129,874,661 N32S probably null Het
Ppp1r1c A G 2: 79,708,231 I20V possibly damaging Het
Prdm13 G T 4: 21,679,464 A342E unknown Het
Prkd3 C A 17: 78,983,546 R180L probably damaging Het
Prune2 T C 19: 17,121,910 F1593L probably benign Het
Rims2 T A 15: 39,292,208 C95S probably damaging Het
Stard9 A G 2: 120,697,791 M1510V probably benign Het
Taf12 A G 4: 132,282,995 I92V probably benign Het
Tma16 C T 8: 66,484,171 probably null Het
Tssk5 G A 15: 76,374,543 R48C probably benign Het
Wwtr1 T C 3: 57,575,259 probably null Het
Zfp286 C G 11: 62,780,204 G348R probably damaging Het
Zfp473 T A 7: 44,733,254 T552S probably damaging Het
Zzef1 T C 11: 72,872,639 F1371L probably benign Het
Other mutations in Cpne6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Cpne6 APN 14 55512730 missense probably damaging 1.00
IGL01306:Cpne6 APN 14 55515249 missense probably damaging 1.00
IGL01548:Cpne6 APN 14 55512726 missense probably damaging 0.99
IGL01867:Cpne6 APN 14 55513680 missense probably benign 0.16
IGL01902:Cpne6 APN 14 55512750 missense possibly damaging 0.80
IGL02669:Cpne6 APN 14 55513826 missense probably benign 0.09
IGL02695:Cpne6 APN 14 55514580 missense probably damaging 1.00
IGL03082:Cpne6 APN 14 55516303 missense probably damaging 1.00
ANU23:Cpne6 UTSW 14 55512002 missense probably benign 0.05
ANU23:Cpne6 UTSW 14 55515249 missense probably damaging 1.00
R0504:Cpne6 UTSW 14 55514602 missense probably damaging 0.99
R1472:Cpne6 UTSW 14 55514635 missense probably benign 0.00
R1538:Cpne6 UTSW 14 55515220 missense possibly damaging 0.92
R1898:Cpne6 UTSW 14 55517028 missense possibly damaging 0.88
R2679:Cpne6 UTSW 14 55516329 missense possibly damaging 0.94
R4235:Cpne6 UTSW 14 55513600 intron probably benign
R4471:Cpne6 UTSW 14 55516632 missense probably damaging 1.00
R4823:Cpne6 UTSW 14 55517010 missense probably damaging 1.00
R5171:Cpne6 UTSW 14 55512148 missense possibly damaging 0.71
R5243:Cpne6 UTSW 14 55512747 missense probably damaging 1.00
R5999:Cpne6 UTSW 14 55513059 missense probably benign
R6111:Cpne6 UTSW 14 55514634 missense probably benign 0.18
R6475:Cpne6 UTSW 14 55513653 missense probably damaging 1.00
R6535:Cpne6 UTSW 14 55513665 missense probably benign 0.30
R6787:Cpne6 UTSW 14 55515244 missense probably damaging 1.00
R7318:Cpne6 UTSW 14 55514294 missense possibly damaging 0.95
R7453:Cpne6 UTSW 14 55512016 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GTACCCCAGATTCAGAAGTCAGC -3'
(R):5'- AGTTGGAATGCAGACCTGGC -3'

Sequencing Primer
(F):5'- CCAGATTCAGAAGTCAGCTAAGAAAG -3'
(R):5'- GAATGCAGACCTGGCCCAAG -3'
Posted On2015-07-21